Cytochrome c
Cytochrome c is a heme-containing protein involved in the electron transport chain of cellular respiration. It is an essential component of the mitochondrial respiratory system, playing a crucial role in the production of cellular energy in the form of ATP.
Lab products found in correlation
89 protocols using cytochrome c
Mitochondrial Protein Profiling in Cells
Immunoblotting of Apoptosis Regulators
Apoptosis Signaling Pathways Analysis
Apoptosis Signaling Pathway Characterization
Antibody selection for Western blot, IF, and FC
Mitochondrial Protein Expression Analysis
Chaetocin Induces Melanoma Cell Apoptosis
Protein Extraction and Western Blot Analysis
Mitochondrial Dynamics in Cardiomyocytes
RNA was extracted with RNAisoPlus (#9189Q, Takara, Japan), cDNA was synthesized with aPrimeScript™ RT Reagent Kit with gDNA Eraser (#RR047Q, Takara), and quantitative RT-PCR was performed with SYBR® Premix Ex Taq™ II (#RR820L, Takara). All procedures were performed strictly following the manufacturers' protocols. The primer sequences are as follows: Mfn2 forward CTTGAAGACACCCACAGGAACA, Mfn2 reverse GGCCAGCACTTCGCTGATAC; Actin forward GTCCCTCACCCTCCCAAAAG, and actin reverse GCTGCCTCAACACCTCAACCC.
Protein Quantification and Western Blot Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!