Pcdna3.1 control

Small interfering RNAs (siRNAs) for SNHG5 and ZEB1 and control siRNA were provided by RiboBio. The siRNA sequences were as below: si‐SNHG5, 5′‐AGUAAUAACAAAAAGGAACAU‐3′; si‐ZEB1, 5′‐GGATAAAGAGATGGAAGAA‐3′. miR‐205‐5p mimic, NC mimic, miR‐205‐5p inhibitor and NC inhibitor were also provided by RiboBio. A SNHG5 overexpression vector (pcDNA3.1/SNHG5) and empty vector (pcDNA3.1/Control) were obtained from GeneChem Co.. Vectors containing short hairpin RNAs targeting SNHG5 (sh‐SNHG5) and negative control vector (sh‐NC) were also provided by GeneChem Co.. The sequences of sh‐SNHG5 and SNHG5 overexpressing vectors are listed in Table S1. Lipofectamine 2000 (Invitrogen) was used to transfect the above RNA oligoribonucleotides or constructs into ccRCC cells following the manufacturer's recommendation.