Biotin 16 dutp

Genomic DNA was isolated and used for a linear multiplex amplification reaction which was performed at 55°C, as previously described [10 (link)]. The PCR mixture for linear DNA amplification and labelling contained DNA (0.5μg) in a total volume of 10 μl, mixed with 1μl of 10x Therminator amplification buffer, 0.1μl Therminator DNA polymerase (BioLabs), 1μl of virulence primer-mix (0.135 μM per oligonucleotide in the stock solution), 1μl of dNTP-mix including the biotin label (1mM dACGTP; 0.65mM dTTP) and 0.35μl Biotin-16-dUTP (1 mM Biotin-16-dUTP, Roche). Hybridization was achieved using the HybridisationPlusKit (Alere Technologies, Jena, Germany) employing a heated mixer (Thermomixer, Eppendorf, Hamburg, Germany). Single-stranded labelled amplified products were hybridised to the arrays as described previously [18 ] and signals read on an ArrayMate apparatus (Alere Technologies, Jena, Germany) using IconoClust software (standard version; Inverness Technologies, Jena, Germany) [17 (link)].

For the 42 males selected from 22 localities (including five specimens collected in 2005 and 2007 from two localities), the best preparations were used for fluorescence in situ hybridization. FISH was carried out as described previously^{21 (link)} using an 18S rDNA probe from orthopteran labelled through PCR with biotin-16-dUTP (Roche Diagnostics GmbH, Germany). A probe from the telomeric DNA sequence (TTAGG)_n was generated by PCR in the absence of a template, using TTAGG_F (5′- TAA CCT AAC CTA ACC TAA CCT AA-3′) and TTAGG_R (5′-GGT TAGGTT AGG TTA GGT TAG G-3′)^{29 (link)} as primers. The visualization of hybridized DNA labelled with biotin-16-dUTP or digoxigenin-11-dUTP (Roche, Diagnostics GmbH, Germany) was performed with avidin-FITC (Invitrogen, USA) or anti-digoxigenin rhodamine (Roche Diagnostics GmbH, Germany), respectively. Digital images were obtained using a CCD DS-U1 camera coupled to fluorescence microscope. The software NIS-Elements BR2 was used for camera control and the merging of DAPI and fluorochrome images of the paints.

Genomic DNA was extracted from a chromosome preparation of Glyphorynchus spirurus (Furnariidae-Passeriformes), with DNAzol [22 (link)]. Primers were designed using Pick primer software of the NCBI platform, from a mRNA partial sequence for Histone H5 from Manacus vitelinicus (Pipridae-Passeriformes), with the sequences H5F 5’- CTACAAGGTGGGCCAGAACG and H5R 5’- TCGTAGATGAGCCCCGAGAT. Probes of Histone H5 and 18S rDNA (Prochilodus argenteus) were labelled with digoxigenin or biotin by PCR and FISH experiments were carried out following the procedure previously described [23 (link)].
Chromosome painting was performed with GGA (Chromosomes 1–9) and BOE whole chromosome probes according to [18 (link)]. Both probe kits were produced from chromosomes isolated by flow cytometry at the Cambridge Resource Centre for Comparative Genomics, Department of Veterinary Medicine, University of Cambridge, UK. Primary DOP-PCR products of whole sorted chromosomes were labelled either with biotin-16-dUTP (Boehringer Mannheim), fluorescein isothiocyanate-12-dUTP (Amersham), or Cy3-dUTP by taking 1μl of product to a second round of DOP-PCR using the same primer. The biotin probes were detected with avidin-Cy3 or avidin-FITC.

Specific painting probes were generated from fibroblast cultures of a female of O. moojeni, with 2n = 70 and heteromorphic X chromosomes, in the Cambridge Resource Centre for Comparative Genomics, Department of Veterinary Medicine, University of Cambridge, UK. The whole chromosome probes were made by degenerate oligonucleotide-primed polymerase chain reaction (DOP-PCR) as previously described [22 (link),23 (link)]. Briefly, the chromosomes were prepared as described and stained with Hoechst 33258 (2 μg/ml) and Chromomycin A3 (40 μg/ml) in the presence of magnesium sulfate (2.5 mmol/l) for 2 h. Sodium sulfite (25 mmol/l) and sodium citrate (10 mmol/l) were added 15 min prior to flow sorting. Chromosome sorting was performed using a dual-laser cell sorter (MoFlo; Beckman Coulter). Approximately 400 chromosomes were sorted from each peak in the flow karyotypes directly into PCR tubes containing 30 μl of distilled water. Each sample was amplified by DOP-PCR using the primer 6MW [22 (link)]. Primary PCR products were labeled with biotin-16-dUTP (Boehringer Mannheim) or fluorescein isothiocyanate (FITC)-12-dUTP (Amersham) by taking 1 μl of product to a second round of DOP-PCR using the same primer. The biotin probes were detected with avidin-Cy3 or avidin-FITC.

For chromosomal painting studies we used kits produced at the Cambridge Resource Centre for Comparative Genomics, Department of Veterinary Medicine, University of Cambridge, UK, by separation of whole chromosomes using flow cytometry (chromosomes 1–9 of Gallus gallus - GGA - and all chromosomes of Burhinus oedicnemus - BOE). From the products of the primary PCR performed to amplify the DNA of the isolated chromosomes, a second round of DOP-PCR, using 1 µl of product, allowed its labelling with Cy3-dUTP, biotin-16-dUTP (Boehringer Mannheim) or fluorescein isothiocyanate − 12-dUTP (Amersham), subsequently detected with avidin-FITC or avidin-FITC.
For the hybridization experiments, metaphase chromosome preparations were aged for 1 h at 65 °C and treated in 1 % pepsin for 5 min. Chromosomal DNA was denatured at 60 °C in 70 % formamide for 30 seconds. The probes were denatured under the same conditions. The probes were hybridized for three days at 37 °C. After that the slides were washed twice in formamide 50 %, 2xSSC, and once in 4xSSC/Tween at 40˚C. For visualization of the biotin-labelled probes a layer of Cy3-a or Cy5-avidin (1:1000 dilution; Amersham) was used. For FITC-labelled probes we used a layer of rabbit anti-FITC (1:200; DAKO). Slides were mounted in a mounting medium with DAPI called Vectashield (Vector Laboratories) [32 (link)].

For FISH experiments, the chromosomes were treated according to the procedures described by Pinkel et al. [55] (link), using high stringency conditions. The probes were labelled by PCR with biotin-16-dUTP (Roche Applied Science) and the signal was detected with avidin-FITC (Roche Applied Science), or else they were labelled with digoxigenin-11-dUTP (Roche Applied Science) and the signal was detected with anti-digoxigenin-rhodamine (Roche Applied Science). The images were captured with a digital camera (Olympus DP70) attached to an Olympus BX61 epifluorescence photomicroscope. Image treatment, including karyotype mounting and optimisation of brightness and contrast, was performed using the Adobe Photoshop CS4 program.

Chromosomal samples were prepared from bone marrow cells of mouse line #9. The mice were injected intraperitoneally with 0.1 mg/μL colcemid and euthanised approximately 60 min afterwards. Chromosome isolation and FISH were performed as described with modification^{29 (link),30 (link)}. Each DNA probe, Adamts20 (15qE3), K18N (15qF2), and G41405N (15qF2), was amplified from the genomic DNA of a C57BL/6NCrSlc mouse by PCR (Supplementary Table 3). Adamts20 (15qE3) was labelled with Biotin-16-dUTP (Roche, Mannheim, Germany), and K18N (15qF2) and G41405N (15qF2) were labelled with Digoxigenin-11-dUTP (Roche), respectively. DNA probes were detected with Streptavidin Alexa Fluor® 488 conjugate (Thermo Fisher Scientific) or anti-digoxigenin-Rhodamine (Roche). Finally, the chromosomes were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche).