Log In Sign up
The largest database of trusted experimental protocols

Superscript rt kit

Manufactured by Toyobo
Visit Supplier
Sourced in Japan

The Superscript RT kit is a reverse transcription kit designed for the conversion of RNA to cDNA. The kit includes the necessary reagents and enzymes required for this process.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green pcr master mix kit, by Toyobo (9 mentions) Trizol reagent, by Tiangen Biotech (8 mentions) Trizol, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Sybr green supermix kit, by Toyobo (2 mentions) Nanodrop 1000 spectrophotometer, by Agilent Technologies (2 mentions) Sybr prime script qrt pcr kit, by Takara Bio (1 mentions) Sybr primescript rt qpcr kit, by Takara Bio (1 mentions) Rneasy column, by Qiagen (1 mentions) Quantstudio 7, by Thermo Fisher Scientific (1 mentions) Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions) Superscript reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Ecl chemiluminescence system, by Santa Cruz Biotechnology (1 mentions) Nitrocellulose membrane, by GE Healthcare (1 mentions)

14 protocols using superscript rt kit

1

Total RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells using the TRIzol reagent (Tiangen), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO) following the manufacturer’s instructions. PCR amplification was performed using the SYBR Green PCR master mix Kit (TOYOBO). All quantitations were normalized to the level of endogenous control GAPDH.
Lin G., Huang T., Zhang X, & Wang G. (2022). Deubiquitinase USP35 stabilizes BRPF1 to activate mevalonate (MVA) metabolism during prostate tumorigenesis. Cell Death Discovery, 8, 453.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the frozen pulverized tissues using Trizol (Invitrogen), and cDNA synthesis was performed using the Superscript RT kit (TOYOBO, Japan) according to the manufacturer's instructions. qRT-PCR analysis was conducted using the SYBR Green Supermix kit (Toyobo, Osaka, Japan) in combination with QuantStudioImage 1 7 (Life Technologies, USA) according to the manufacturer’s instructions. With the paired primers, Nogo-B forward: 5′-GCTCCTCGGGCTCAGTGGTTGTTGAC-3′ and reverse: 5′-TGGCCTTCATCTGATTTCTGGATAGC-3′, β2-microglobulin forward: 5′-ATGAGTATGCCTGCCGTGTGAAC-3′, and reverse: 5′-TGTGGAGCAACCTGCTCAGATAC-3′, A2M forward: 5′-CTATGATTACTACGAGACGGAT-3′, and reverse: 5′-CACTTTTCAGCCTTGTGGTC-3′, CRP forward: 5′-TCAAAGCCTTCACTGTGTGC-3′, and reverse: 5′-AGGTGAGTTGGATCCACAGG-3′, VEGF forward: 5′-GGCCTCTGAAACCATGAACT-3′, and reverse: 5′-ATGCTGCAGGAAGCTCATCT-3′, SOCS3 forward: 5′-CCTGCGCCTCAAGACCTTC-3′, and reverse: 5′-GTCACTGCGCTCCAGTAGAA-3′, respectively.
Zhu B., Chen S., Hu X., Jin X., Le Y., Cao L., Yuan Z., Lin Z., Jiang S., Sun L, & Yu L. (2017). Knockout of the Nogo-B Gene Attenuates Tumor Growth and Metastasis in Hepatocellular Carcinoma. Neoplasia (New York, N.Y.), 19(7), 583-593.
+ Open protocol
+ Expand
3

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from transiently transfected cells using the TRIzol reagent (Tiangen, Shanghai, China), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO, Osaka, Japan), according to the manufacturer's instructions. PCR amplification was performed using the SYBR Green PCR master mix Kit (TOYOBO). All quantization were normalized to the level of endogenous control GAPDH.
Zhang P., Gao K., Jin X., Ma J., Peng J., Wumaier R., Tang Y., Zhang Y., An J., Yan Q., Dong Y., Huang H., Yu L, & Wang C. (2015). Endometrial cancer-associated mutants of SPOP are defective in regulating estrogen receptor-α protein turnover. Cell Death & Disease, 6(3), e1687-.
+ Open protocol
+ Expand
4

Total RNA Isolation and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from cells using the TRIzol reagent (Tiangen), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO) following the manufacturer’s instructions. PCR amplification was performed using the SYBR Green PCR master mix Kit (TOYOBO). All quantitations were normalized to the level of endogenous control GAPDH. The sequences of Primers for qRT-PCR were listed in Additional file 2: Table S1.
Shi Q., Zhu Y., Ma J., Chang K., Ding D., Bai Y., Gao K., Zhang P., Mo R., Feng K., Zhao X., Zhang L., Sun H., Jiao D., Chen Y., Sun Y., Zhao S.M., Huang H., Li Y., Ren S, & Wang C. (2019). Prostate Cancer-associated SPOP mutations enhance cancer cell survival and docetaxel resistance by upregulating Caprin1-dependent stress granule assembly. Molecular Cancer, 18, 170.
+ Open protocol
+ Expand
5

Quantifying KDM4B Expression in Tissues

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from fresh tissues was extracted by TRIzol (15596026, Invitrogen) at 4°C. cDNA was constructed using a Superscript RT kit (TOYOBO). Gene expression was quantified using the SYBR Green PCR Master Mix Kit (TOYOBO). GAPDH was used as an internal control. The expression of KDM4B was normalized to that of GAPDH. Primers for KDM4B and GAPDH were previously described by Wu et al [14 (link)].
Tang H., Guan Y., Yuan Z., Guo T., Tan X., Fan Y., Zhang E, & Wang X. (2023). Histone demethylase KDM4B contributes to advanced clear cell renal carcinoma and association with copy number variations and cell cycle progression. Epigenetics, 18(1), 2192319.
+ Open protocol
+ Expand
6

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from transfected cells using the TRIzol reagent (Invitrogen), and the concentration was measured by NanoDrop1000 Spectrophotometer (Agilent). cDNA was reversed transcribed by the Superscript RT kit (TOYOBO) according to the manufacturer’s instructions. qRT-PCR amplification was performed using the SYBR Prime Script qRT-PCR kit (Takara). All quantization was normalized to the level of internal control GAPDH. Primer sequences are shown in Supplementary Table 7.
Dong X., Wang F., Liu C., Ling J., Jia X., Shen F., Yang N., Zhu S., Zhong L, & Li Q. (2021). Single-cell analysis reveals the intra-tumor heterogeneity and identifies MLXIPL as a biomarker in the cellular trajectory of hepatocellular carcinoma. Cell Death Discovery, 7, 14.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from transfected cells using the TRIzol reagent (Invitrogen), and the concentration was measured by NanoDrop1000 Spectrophotometer (Agilent, USA). cDNA was reversed transcribed by the Superscript RT kit (TOYOBO), according to the manufacturer’s instructions. qRT-PCR amplification was performed using the SYBR Prime Script RT-qPCR kit (Takara, Japan). All quantization was normalized to the level of internal control GAPDH. The primer sequences for qRT-PCR were listed in Supplementary Table 1.
Dong X., Han Y., Zhang E., Wang Y., Zhang P., Wang C., Zhong L, & Li Q. (2021). Tumor suppressor DCAF15 inhibits epithelial-mesenchymal transition by targeting ZEB1 for proteasomal degradation in hepatocellular carcinoma. Aging (Albany NY), 13(7), 10603-10618.
+ Open protocol
+ Expand
8

Comprehensive RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted from the fresh cells using Trizol (Invitrogen), followed by further purification with RNEasy columns (Qiagen). RNAs were reversely transcribed to cDNAs using the Superscript RT kit (TOYOBO, Japan) according to the manufacturer’s instructions. qRT-PCR analysis was conducted using the SYBR Green Supermix kit (Toyobo, Osaka, Japan) in combination with QuantStudio™ 7 (Life technologies, USA). The cycle parameters were one hot starting cycle at 95 °C for a 1-min, following with 40 cycles of 95 °C for 10 s, 60 °C for 10 s and 72 °C for 30 s. Gene expression levels were normalized by housekeeping gene β2MG, with the paired primers (Forward: 5′-ATGAGTATGCCTGCCGTGTGAAC-3′, Reverse: 5′-TGTGGAGCAACCTGCT CAGATAC-3′). The paired primers of TP53, KRAS, NPM1, ATRX and MAPT were listed in Table S8.
Zhu B., He Q., Xiang J., Qi F., Cai H., Mao J., Zhang C., Zhang Q., Li H., Lu L., Wang T, & Yu W. (2017). Quantitative Phosphoproteomic Analysis Reveals Key Mechanisms of Cellular Proliferation in Liver Cancer Cells. Scientific Reports, 7, 10908.
+ Open protocol
+ Expand
9

Quantifying Bladder Cancer Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from bladder cancer cells using the TRIzol reagent (Tiangen), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO) following the manufacturer's instructions. An equal amount of RNA (2 μg) was reverse transcribed into complementary DNA (cDNA) using Superscript Reverse Transcriptase (Applied Biosystems, USA). Quantitative real-time PCR (qRT-PCR) was performed on the ABI 7500 real-time PCR system (Applied Biosystems, USA). All quantitations were normalized to the level of endogenous control GAPDH.
Wang X., He H., Rui W., Zhang N., Zhu Y, & Xie X. (2021). TRIM38 triggers the uniquitination and degradation of glucose transporter type 1 (GLUT1) to restrict tumor progression in bladder cancer. Journal of Translational Medicine, 19, 508.
+ Open protocol
+ Expand
10

Analyzing lncRNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA isolations were conducted using TRIzol Reagent (Invitrogen, US), and total cDNA was synthesized using the Superscript RT Kit (TOYOBO, Japan). Real-time PCR was performed using the SYBR Green PCR Master Mix Kit (TOYOBO, Japan). Endogenous glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization. The primers used in this study are as follows: LncRNA ASB16-AS1 forward: CGGCCCTGAGGCAAACATAC, reverse: TGAAACACTGCGCCAACTTC; miR-185-5p forward: CCATGTGCCTGTGTCATGC, reverse: ATCTGCTGATCCCCGCCA; miR-214-3p forward: ACACTCCAGCTGGGACAGCAGGCACAGACA, reverse: TGGTGTCGTGGAGTCG; LARP1 forward: GCAACCTAAAGACACTAC reverse: CCTCTTCTTCACTTCAATC; GAPDH forward: GCCTGCTTCACCACCTTCT, reverse: GAACGGGAAGCTCACTGG. The 2 -ΔΔCt method was used to calculate relative expression levels.
Li M., Yin B., Chen M., Peng J., Mu X., Deng Z., Xiao J., Li W, & Fan J. (2021). Downregulation of the lncRNA ASB16-AS1 Decreases LARP1 Expression and Promotes Clear Cell Renal Cell Carcinoma Progression via miR-185-5p/miR-214-3p. Frontiers in Oncology, 10, 617105.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!