Ribofect cp transfection agent

Manufactured by RiboBio

Sourced in China

RiboFECT CP Transfection Agent is a cationic polymer-based transfection reagent designed for efficient delivery of nucleic acids, including plasmid DNA, siRNA, and mRNA, into a variety of mammalian cell types. It forms stable complexes with nucleic acids and facilitates their entry into the target cells.

Automatically generated - may contain errors

Lab products found in correlation

Pcmv6 entry vector, by RiboBio (1 mentions) 293t cell, by American Type Culture Collection (1 mentions) H1299, by American Type Culture Collection (1 mentions) Hcc827, by American Type Culture Collection (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

RiboFECT™ CP (99 citations) RiboFECT (12 citations) RiboFECT CP Transfection (2 citations)

9 protocols using ribofect cp transfection agent

siRNA-Mediated Gene Silencing Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering RNAs (siRNAs) were synthetized by RIBOBIO (Guangzhou, China). Cells were cultured on six-well plates to confluence and transfected with siRNA using riboFECTTM CP Transfection Agent (RIBOBIO, C10511-1) according to the manufacture’s instruction. The RNA interference sequences were listed in Table 3.Table 3.

Target sequences of siRNAs

Genes	Target sense (5’-3’)
SDC1	CCGCAAATTGTGGCTACTAAT
TGM2	ACAGCAACCTTCTCATCGAGT
EPG5	CCTTTAATAGAGCACGCTATA
Negative control	TTCTCCGAACGTGTCACGT

Zheng W., Chen Q., Liu H., Zeng L., Zhou Y., Liu X., Bai Y., Zhang J., Pan Y, & Shao C. (2022). SDC1-dependent TGM2 determines radiosensitivity in glioblastoma by coordinating EPG5-mediated fusion of autophagosomes with lysosomes. Autophagy, 19(3), 839-857.

+ Open protocol

+ Expand

Evaluating Autophagy Regulators in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

CNE1 and CNE1-R cells were transferred with ANXA6 siRNA (siANXA6) (target sequence: CGG GCA CTT CTG CCA AGA AAT), LC3 siRNA (siLC3) (target sequence: GAG UGA GAA AGA UGA AGA UTT), and siRNA negative control of random sequence using riboFECTTM CP Transfection Agent (Ribobio, Guangzhou, China). The transfection efficiency was evaluated by PCR at 24–72 h after transfection, and the survival of siLC3 transfected cells was measured with a colony formation assay.

Chen Q., Zheng W., Zhu L., Yao D., Wang C., Song Y., Hu S., Liu H., Bai Y., Pan Y., Zhang J., Guan J, & Shao C. (2020). ANXA6 Contributes to Radioresistance by Promoting Autophagy via Inhibiting the PI3K/AKT/mTOR Signaling Pathway in Nasopharyngeal Carcinoma. Frontiers in Cell and Developmental Biology, 8, 232.

+ Open protocol

+ Expand

Silencing SOCS2, elongin B, and elongin C in HCC cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturer’s instruction, HCC cells were respectively transfected with the SOCS2-specific siRNA, elongin B specific siRNA and elongin C specific siRNA at a final concentration of 100 nM using riboFECTTM CP Transfection Agent (RiboBio CO., Ltd, Guangzhou, China). A scrambled siRNA was applied as a negative control. The transfection efficiency was evaluated by Western blot assay at 48-72 h after transfection. The sequences of siRNAs were as follows. siSOCS2: 5′- GAA GGA ACT TTC TTG ATTA-3′; sielongin B: 5′-GGG AAG CAG UGC CAA UGA AdTdT-3′; sielongin C: 5′-AAG AGA ACA UGC AUU AAC AdTdT-3′; siNC: 5′-TTC TCC GAA CGT GTC ACGT-3′.

Chen Q., Zheng W., Guan J., Liu H., Dan Y., Zhu L., Song Y., Zhou Y., Zhao X., Zhang Y., Bai Y., Pan Y., Zhang J, & Shao C. (2022). SOCS2-enhanced ubiquitination of SLC7A11 promotes ferroptosis and radiosensitization in hepatocellular carcinoma. Cell Death and Differentiation, 30(1), 137-151.

+ Open protocol

+ Expand

CD81 Silencing in Glioma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD81 siRNA (target sense: 5′-AATTGAAGACGAAGAGCAG-3′) and its negative control (target sense: 5′-TTCTCCGAACGTGTCACGT-3′) (RIBOBIO, Guangzhou, China) (final concentration: 100 nM) were respectively transfected into U251R and T98G cells using riboFECT^TM CP Transfection Agent (RIBOBIO) according to the manufacture’s instruction. At 24 h after siRNA transfection, cells were exposed to irradiation or other treatments.

Zheng W., Chen Q., Liu H., Hu S., Zhou Y., Bai Y., Zhang J., Pan Y, & Shao C. (2021). CD81 Enhances Radioresistance of Glioblastoma by Promoting Nuclear Translocation of Rad51. Cancers, 13(9), 1998.

+ Open protocol

+ Expand

KRAS Modulation in Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The A549 cell line was transfected with small interfering RNA (siRNA) against KRAS or negative control(RiboBio, Guangzhou, China), denoted as siRNA KRAS, siRNA NC (siRNA sense: 3′-GGACGAATATGATCCAACA-5′).The H1299 cell line was transfected with the KRAS plasmid or pCMV6 Entry vector (RiboBio, Guangzhou, China), denoted as KRAS OE, KRAS NC. Transfection was performed using riboFECT™ CP Transfection Agent (RiboBio, Guangzhou, China) with a 50 nM concentration following the manufacturer's protocol.

Xia M., Li X., Diao Y., Du B, & Li Y. (2020). Targeted inhibition of glutamine metabolism enhances the antitumor effect of selumetinib in KRAS-mutant NSCLC. Translational Oncology, 14(1), 100920.

+ Open protocol

+ Expand

Modulating Autophagy in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HONE1, CNE2, and CNE2R cells were transferred with CASC19 siRNA (siCASC19) or LC3 siRNA (siLC3) using riboFECT CP Transfection Agent (RiboBio, Guangzhou, China) according to the manufacture’s protocol. The sequences of siRNAs are listed as follows: siCASC19-1 (GCT CAG CAT TTG CCA TACT), siCASC19-2 (CCT TAG AAT TGG AGT GCCT), siLC3 (GAG UGA GAA AGA UGA AGA UTT). The negative control of siRNA has a random sequence. Transduction efficiency was consistently between 90 and 95%. 3-MA (MCE, HY-19312) and rapamycin (MCE, AY-22989) were used as the autophagy inhibitor and autophagy inducer, respectively. CNE2R cells were treated with 5 mM 3-MA or 0.1 µM rapamycin for 6 h.

Liu H., Zheng W., Chen Q., Zhou Y., Pan Y., Zhang J., Bai Y, & Shao C. (2021). lncRNA CASC19 Contributes to Radioresistance of Nasopharyngeal Carcinoma by Promoting Autophagy via AMPK-mTOR Pathway. International Journal of Molecular Sciences, 22(3), 1407.

+ Open protocol

+ Expand

miR-4458 Regulation of HMGA1 in Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

A549, H1299, HCC827, PC9, HBE, 293 T cell lines were purchased from American Type Culture Collection (Manas-sas, VA, USA). All cells were cultured at 37°C in an incubator with 5% CO₂. miR-4458 mimics (mimics), negative control (NC), miR-4458 inhibitor (inhibitor), and inhibitor negative control (inhibitor NC) were used (RiboBio, Guangzhou, China) for the overexpression and knockdown of miR-4458. The si-HMGA1 was conducted for the knockdown of HMGA1 and si-NC was used as the control. Transfection of cells was performed using riboFECT^™ CP Transfection Agent (RiboBio, Guangzhou, China) with a 100 nM concentration following the manufacturer’s protocol.

Ma Y., Li X., Chen S., Du B, & Li Y. (2019). MicroRNA-4458 suppresses migration and epithelial–mesenchymal transition via targeting HMGA1 in non-small-cell lung cancer cells. Cancer Management and Research, 11, 637-649.

+ Open protocol

+ Expand

MMP14 Silencing in Glioblastoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

U251, U251R, and T98G cells were transfected with MMP14 siRNA (siMMP14) using riboFECT CP Transfection Agent (RiboBio, Guangzhou, China) according to the manufacturer’s protocol. The sequences of siRNAs are listed as follows: siMMP14 (5′ GGT CTC AAA TGG CAA CAT A 3′). The negative control siRNA had a random sequence. The transduction efficiency was consistently between 90% and 95%. U251, U251R, and T98G cells were treated with 5 mM SAHA for 24 h.

Zhou Y., Liu H., Zheng W., Chen Q., Hu S., Pan Y., Bai Y., Zhang J, & Shao C. (2021). MMP14 Contributes to HDAC Inhibition-Induced Radiosensitization of Glioblastoma. International Journal of Molecular Sciences, 22(19), 10403.

+ Open protocol

+ Expand

Overexpression and Knockdown of SDC1, TGM2, FLOT1, and BHMT

Check if the same lab product or an alternative is used in the 5 most similar protocols

To overexpress SDC1 and TGM2 (oeSDC1 and oeTGM2), the cells were transfected with pcDNA3.1 (Invitrogen™, USA) or its negative control (oe-NC). Meanwhile, two specific siRNAs of SDCA, TGM2, FLOT1 or BHMT were designed and offered by GenePharma (Shanghai, China). U251R and U87 cells were transferred with SDC1 siRNA (siSDC1), TGM2 siRNA (siTGM2), FLOT1 siRNA (siFLOT1), BHMT siRNA (siBHMT) or negative control siRNA (siNC) using riboFECT CP Transfection Agent (RiboBio, Guangzhou, China), according to the manufacture's protocol. At 24 h after transfection, cells were exposed to irradiation or other treatments. The interfering efficiency was identified by Western blot assay at 24-72 h after transfection. The RNA interference sequences were listed in Supplementary Table S3.

Zeng L., Zheng W., Liu X., Zhou Y., Jin X., Xiao Y., Bai Y., Pan Y., Zhang J, & Shao C. (2023). SDC1-TGM2-FLOT1-BHMT complex determines radiosensitivity of glioblastoma by influencing the fusion of autophagosomes with lysosomes. Theranostics, 13(11), 3725-3743.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!