The oligonucleotide used to specifically knock down JPH2 protein expression via steric inhibition of mRNA translation (morpholino) was designed and synthesized by Gene Tools. The sequence of the Jph2-targeting morpholino was 5′-TCA TCT CAT CCT CGC TCC TGA CAA C-3′. A nonsilencing morpholino (5′-CCT CTT ACC TCA GTT ACA ATT TAT A-3′; Gene Tools) with no known binding targets in rodents was used as a control for all experiments. After aseptically dissecting intact arteries from the brain or mesentery, morpholinos were delivered into SMCs by placing arteries in a 24-well plate containing 1 mL of serum‐free DMEM (Thermo Fisher Scientific) supplemented with Endo-Porter transfection reagent (6 µM; Gene Tools) and 10 µM control or Jph2-targeting morpholinos. Transfected cerebral arteries were cultured in this solution at 37 °C/5% CO2 for 48 h prior to experimentation. The efficiency of JPH2 knockdown was determined by comparing JPH2 protein expression levels in cerebral arteries treated with control and Jph2-targeting morpholinos using the Wes protein analysis system.
Endo porter transfection reagent
Manufactured by Gene Tools
Sourced in United States
Endo-Porter is a transfection reagent designed to facilitate the delivery of macromolecules, such as oligonucleotides, peptides, and proteins, into the cytoplasm of cells. It is a lipid-based formulation that promotes the endocytosis and subsequent endosomal release of the transported cargo.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions)
Fetal bovine serum (fbs), by Atlanta Biologicals (2 mentions)
Pdgf aa, by Thermo Fisher Scientific (2 mentions)
Ham s f10, by Thermo Fisher Scientific (2 mentions)
Horse serum, by Thermo Fisher Scientific (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Dulbecco s modified essential medium, by Thermo Fisher Scientific (2 mentions)
Qiazol, by Qiagen (2 mentions)
Morpholino, by Gene Tools (1 mentions)
L 15 medium, by Merck Group (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions)
Axioplan 2 microscope, by Zeiss (1 mentions)
Alexa fluor 568 phalloidin, by Thermo Fisher Scientific (1 mentions)
11 protocols using endo porter transfection reagent
1
Targeted JPH2 knockdown in SMCs
2
Morpholino-Mediated Targeting of Intronic Regulatory Elements
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Morpholinos were designed to target two polyadenylation sites on the intronic variant (pA1: 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA2: 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For in vitro treatment, cells were grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (Atlanta Biologicals). Cells were incubated in 10 μM of the indicated morpholino using the Endo-Porter transfection reagent (Gene Tools, LLC). Cells were harvested at 24 hours for qPCR analysis with RNA isolated using the RNeasy Plus Mini kit with on-column Dnase digestion per manufacturer’s instructions (Qiagen). For Western blot analysis, cells were transfected for 24 hours in Ham’s F10 (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with serum-free Ham’s F10 (Invitrogen) and incubated for an additional 24 hours. For signaling assays, cells were then incubated for 15 minutes with PDGF-AA (Peprotech) at 0.1 ng/ml or 20 ng/ml for cells treated with pA-AMOs or the 5′ss-AMO, respectively, and lysed for Western blot analysis as described above.
3
Antisense Oligonucleotide Modulation of CADM1 and ANK3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells (ATTC, CRL-2266) were cultured at 37°C, 5% CO2 in Dulbecco’s Modified Essential Medium (Life technologies, US) supplemented with 10% Fetal Bovine Serum. For all treatments in this cell line, cells were seeded to be 70-80% confluent at the day of transfection in 6-well plates.
For antisense oligonucleotide (AON) treatment, cells were transfected at 24 hr with 10 μM of stated AON using Endo-porter transfection reagent (Gene-tools, US) as per manufacturers instructions. At 48 hr post-transfection cell media was removed and cells lysed and RNA extracted with Qiazol. All AONs were purchased from Gene-tools, US, and carried morpholino modifications. Sequences used were:
For antisense oligonucleotide (AON) treatment, cells were transfected at 24 hr with 10 μM of stated AON using Endo-porter transfection reagent (Gene-tools, US) as per manufacturers instructions. At 48 hr post-transfection cell media was removed and cells lysed and RNA extracted with Qiazol. All AONs were purchased from Gene-tools, US, and carried morpholino modifications. Sequences used were:
| CADM1: | |
| AON NS: | CCTCTTACCTCAGTTACAATTTATA |
| AON-A1: | AGCACACATGAGAAGTATGACTTAC |
| AON-A2: | ATCCAAGCATAAGATTGTCACTTAC |
| ANK3: | |
| AON NS: | CCTCTTACCTCAGTTACAATTTATA |
| AON-A1: | TTTAAAATGGAAAACCAGCACTTAC |
| AON-A2: | AATGGCCAATGCCAAGTTCACTTAC |
4
Antisense Oligonucleotide Modulation of CADM1 and ANK3
5
Fibroblast Transfection with AONs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AONs with a phosphorodiamidate morpholino oligomer backbone were obtained from Gene-Tools, LLC (Supplementary Table S1 ). Primary fibroblasts were transfected with AONs at 20 µM using 4.5 µl Endo-Porter transfection reagent (1 mM peptide in DMSO, Gene-Tools, Philomath OR, United States) per ml of medium. Cells were harvested after 3 or 4 days of culturing for mRNA analysis and 5 days of culturing for protein activity measurements.
6
PMO Transfection in DMD Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PMOs targeting exon 50, 51, and 55, listed in Supplementary Table S1 , were synthesized by Nippon Shinyaku Co., Ltd. (Kyoto, Japan). We transfected antisense PMOs at 1, 5, or 10 μM (final concentration) into MYOD1-converted UDCs or MYOD1-converted fibroblasts from DMD patients on the 7th day after differentiation using the Endo-Porter transfection reagent (Gene Tools, Philomath, OR, USA). After 72-h incubation with PMOs, the medium was changed to fresh differentiation medium free of PMOs.
7
Morpholino-Mediated Targeting of Intronic Regulatory Elements
8
Dystrophin Exon 45 Skipping PMO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PMO targeting exon 45 was synthesized by Gene Tools (Philomath, OR, USA). We transfected this PMO (10 μM final concentration) into MYOD1-UDCs from DMD patients on the 7th day after differentiation using the Endo-Porter transfection reagent (Gene Tools, Philomath, OR, USA). After 72 h incubation with the PMO, the medium was changed to fresh PMO-free differentiation medium.
9
In silico Design of 30-mer AOs for DMD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The in silico design of 30-mer AOs targeting DMD exons 45–55 was performed using a predictive software algorithm developed by our group [22 (link)] and PMOs were synthesized by Gene Tools (Oregon, USA). PMOs at 1, 3 or 10 μM each were transfected as a cocktail into differentiated DMD myotubes using 6 μM Endo-Porter transfection reagent (Gene Tools). Cells were incubated with PMO for 48 h and then media was changed to fresh media and cells were incubated an additional 72 h before harvesting for analysis.
10
Exon-v6 Skipping Potential Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To understand the therapeutic potential of exon-v6 skipping, we tested a transient strategy approved in the clinics for other diseases. To this end, we checked the possible splice sites near exon-v6, using Human Splicing Finder online tool [39 (link)], and designed PMOs to target the specific splice acceptor and donor at the 5′ and 3′ sites of exon-v6, respectively. Two PMOs were designed: “CD44v6_BEG” (5′-CTGGACTGTGAGAAGAATATCAGTT-3′), at the 5′ site of exon-v6 and “CD44v6_END” (5′-CTTGTTAAACCATCCATTACCAGCT-3′), at the 3′ site of exon-v6. Both GC cell lines were seeded in 12-well plates and allowed to adhere ON, until approximately 60–70% confluency. In the following day, culture medium was replaced and PMOs (alone or mixed) were transfected into cells using Endo-Porter transfection reagent (Gene Tools, Philomath, OR, USA) and incubated for 48 h. The concentrations of each PMO used to transfect cells were 4 µM along with 2 µM of Endo–Porter. After this period, cells were collected, either for genotyping or immunofluorescence analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!