Maxtract high density

Total genomic DNA was extracted from the excised tissue sample for each specimen using the method of Tsunashima et al. [35 (link)] with some modifications. Briefly, proteinase K-treated samples were subjected to phenol/chloroform extraction with MaXtract High Density (Qiagen, Germantown, MD, USA) following the manufacturer’s protocol. Partial fragments of the 28S rRNA gene (approximately 1100 bp), including the D1–D2 region, were amplified by PCR using the universal primers HRNT-F2 (5′-AGTTC AAGAG TACGT GAAAC C-3′) and HRNT-R2 (5′-AACAC CTTTT GTGGT ATCTG ATGA-3′) [35 (link)]. Partial fragments of the mitochondrial gene (approximately 750 bp), COI, were amplified by PCR using the universal primers HRpra2 (5′-AATAA GTATC ATGTA RACTD ATRTC T-3′) and HRprb2-2 (5′-GDGGV TTTGG DAATT GAYTA ATACC TT-3′) [35 (link)]. The reaction mixture for PCR amplification contained genomic DNA as a template, 0.625 units of TaKaRa ExTaq DNA polymerase (Takara Bio, Otsu, Shiga, Japan), 2 μL of 10× ExTaq DNA polymerase buffer (Takara Bio), 2.6 μL of 10 μM primers, 1.6 μL of 2.5 mM dNTP, and sterile water to bring the total volume up to 20 μL. PCR was done with an initial denaturation at 95 °C for 1 min followed by 35 cycles of denaturation at 95 °C for 10 s, annealing at 50 °C for 30 s, and extension at 72 °C for 2 min.

Total RNA was isolated from cells using Trizol reagent (Life Technologies, Paisley, UK) and purified using MaXtract High Density (QIAGEN, Redwood City, CA). RNA yield and quantity were determined using a Nanodrop spectrophotometer ND-1000 (Thermo Scientific, Wilmington, DE). Total RNA was reverse transcribed to cDNA using oligo(dT) primers and M-MLV reverse transcriptase (Thermo Scientific). PerfeCTa SYBR Green FastMix ROX (Quanta Biosciences; Beverly, MA) was used for real-time PCR according to the manufacturer’s protocol and all the samples were run in triplicate on CFX384 Touch Real-Time system c1000 thermal cycler (Bio-Rad, Hercules, CA). Cycling conditions were 95 °C for 20 s, followed by 40 cycles of 95 °C for 1 s, and 60 °C for 20 s, 65 °C for 5 s. Gene expression levels were normalized to the GAPDH gene. Primers used for qPCR analysis are: CD47 sense- TGCATTAAGGGGTTCCTCTACA; anti-sense- CTCTGTATTGCGGCGTGTAT; GAPDH sense-AGCCTCAAGATCATCAGCAATG; anti-sense-CACGATACCAAAGTTGTCATGGAT.
CD47 expression in each sample was normalized to GAPDH used as endogenous control. The data is presented and Relative quantification (RQ), relative to the untreated cells used as a reference sample.