Log In Sign up
The largest database of trusted experimental protocols

Magna chip g chromatin immunoprecipitation kit

Manufactured by Merck Group
Visit Supplier
Sourced in Germany, United States

The Magna ChIP G Chromatin Immunoprecipitation Kit is a laboratory equipment product designed for chromatin immunoprecipitation (ChIP) experiments. It provides the necessary components to isolate and analyze protein-DNA interactions within a cellular sample.

Automatically generated - may contain errors

Lab products found in correlation

Anti h3k27ac, by Thermo Fisher Scientific (3 mentions) Epitect chip qpcr primer, by Qiagen (2 mentions) H 129, by Santa Cruz Biotechnology (2 mentions) Hmec cells, by Lonza (2 mentions) Anti h3k4me1, by Abcam (2 mentions) Anti cbp, by Thermo Fisher Scientific (2 mentions) Anti foxa1, by Thermo Fisher Scientific (2 mentions) Dimethyl k9 histone h3, by Merck Group (2 mentions) Trimethyl k9 histone h3, by Merck Group (2 mentions) Trimethyl k27 histone h3, by Abcam (2 mentions) Control anti igg antibody, by Merck Group (1 mentions) Anti creb antibody, by Abcam (1 mentions) Normal rabbit igg, by Merck Group (1 mentions) Anti h3k4me3, by Merck Group (1 mentions) Anti rna polymerase 2, by Merck Group (1 mentions) Ez lysis buffer, by Merck Group (1 mentions) High sensitivity dna reagent kit, by Agilent Technologies (1 mentions) Phosphatase inhibitors 2 and 3, by Merck Group (1 mentions) Protease inhibitor cocktail, by Merck Group (1 mentions) Bioanalyzer 2100 system, by Agilent Technologies (1 mentions)

Close spelling variants of this product

ChIP kit (270 citations) Magna ChIP Kit (136 citations) Chromatin Immunoprecipitation Kit (96 citations) Immunoprecipitation Kit (14 citations) ChIP chromatin immunoprecipitation kit (11 citations) Magna ChIP™ A/G One-Day Chromatin Immunoprecipitation Kits (2 citations)

22 protocols using magna chip g chromatin immunoprecipitation kit

1

Chromatin Immunoprecipitation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were grown to 80% confluence and cells were then crosslinked with 1% formaldehyde and processed. The crosslinking, immunoprecipitation, washing, elution, reverse crosslinking, and proteinase K treatment were performed according to the manufacturer’s directions described in the Magna ChIP G Chromatin Immunoprecipitation Kit from Millipore. Purified immunoprecipitated DNA was used for quantitative RT-PCR.
Shi L., Tang X., Qian M., Liu Z., Meng F., Fu L., Wang Z., Zhu W.G., Huang J.D., Zhou Z, & Liu B. (2018). A SIRT1-centered circuitry regulates breast cancer stemness and metastasis. Oncogene, 37(49), 6299-6315.
+ Open protocol
+ Expand
2

Chromatin Immunoprecipitation Assay for CREB

Check if the same lab product or an alternative is used in the 5 most similar protocols
The chromatin immunoprecipitation assay was performed by using the Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore, USA) following the manufacturer's instructions. In brief, about 1 × 107 A549 cells were fixed in 1% formaldehyde and the cell lysates were sonicated into DNA fragments in the range of 200‐1000 bp. The antibody used in the ChIP assays was an anti‐CREB antibody (Abcam, UK), and an anti‐IgG control antibody (Millipore, USA) was used as a negative control. The purified DNA from input or immunoprecipitated samples were assayed by qPCR with SYBR Green SYBR Green I Master Mix (Takara, Japan) after reverse cross‐linking and DNA purification. The primers used were listed as follows: 5′‐GCTCCTACCTAATATCATCCCC‐3′ (sense); 5′‐AGTTATTTCCGGTAACAAGAGC‐3′ (antisense).
Chen J., Feng D., Chen Y., Yang C., Juan C., Cao Q., Chen X., Liu S, & Zhou G. (2020). Long non‐coding RNA MALAT1 targeting STING transcription promotes bronchopulmonary dysplasia through regulation of CREB. Journal of Cellular and Molecular Medicine, 24(18), 10478-10492.
+ Open protocol
+ Expand
3

Chromatin Immunoprecipitation Assay of TLR2 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols
The chromatin immunoprecipitation assay was conducted by using a Magna ChIP G-chromatin immunoprecipitation kit (Millipore, catalogue number 17-611) as we described before (Feng et al., 2014 (link)). Briefly, the hippocampus tissue was cross-linked by 1.5% formaldehyde for 15 min at room temperature. The cross-linking was stopped by glycine and the tissue was washed twice with cold phosphate buffered saline. The cross-linked tissue was grinded, followed by processing with a 28-gauge needle to get homogeneous suspension. The homogenate was subsequently lysed by the cell lysis buffer and nucleus lysis buffer supplied in the kit. About 200 - 500 base pair cross-linked DNA fragments were obtained by sonication. The resulting DNA fragments were incubated with a rabbit polyclonal anti-HMGB1 antibody (Abcam, RRID: AB_444360) or normal rabbit IgG (Millipore, RRID: AB_490574) at 1 μg/450 μl sample overnight, respectively. The immunoprecipitated DNA was used to detect the quantity of a fragment of tlr2 promotor (−283 bp to −71 bp) by PCR assay. The primers were as follows: sense primer: 5’-CATAAGTAGGCAGTTTTGGTCAAGG-3’; anti-sense primer: 5’-GCAAGGATTCTGGAAGGAAGAGGAT-3’.
Lin F., Shan W., Zheng Y., Pan L, & Zuo Z. (2021). Toll-like receptor 2 activation and upregulation by high mobility group box l contribute to postoperative neuroinflammation and cognitive dysfunction in mice. Journal of neurochemistry, 158(2), 328-341.
+ Open protocol
+ Expand
4

Chromatin Immunoprecipitation Protocol for RelA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were grown to 80% confluence, and crosslinking was performed with 1% formaldehyde for 10 min. ChIP assays were performed using a Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore) according to the manufacturer’s instructions. After immunoprecipitation with an antibody to RelA (Cell Signaling Technology, 8242) or normal rabbit IgG, protein-DNA crosslinks were reversed. DNA was then purified to remove the chromatin proteins and analysed by quantitative real-time PCR using the Qiagen EpiTect ChIP qPCR Primers (Cat# GPH1006956(-)01A).
Piao H.L., Yuan Y., Wang M., Sun Y., Liang H, & Ma L. (2014). α-catenin acts as a tumor suppressor in E-cadherin-negative basal-like breast cancer by inhibiting NF-κB signaling. Nature cell biology, 16(3), 245-254.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation of Pokemon Transcription Factor

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation was performed as described (54 (link)) with the Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore) using a hamster monoclonal antibody against Pokemon (LRF) (33 (link)). Primer sequences used for PCR were as follows: Dlk1_4,5_Fwd: cccagggacaggcagtaaggtt, Dlk1_4,5_Rev: ccaaacgcacaccacgaagat. 3T3L1 cells were crossed linked with formaldehyde for 5 minutes and terminated with 0.125M glycine. Cells were sonicated to generate chromatin with average size of 500bp. Monocloncal anti-LRF antibody were first incubated with a hamster bridging antibody (Jackson ImmunoResearch Laboratories), followed by addition of the 3T3L1 chromatin. Immunoprecipitated chromatin was assayed by quantitative PCR using the Dlk1-specific primers.
Guarnerio J., Riccardi L., Taulli R., Maeda T., Wang G., Hobbs R.M., Song M.S., Sportoletti P., Bernardi R., Bronson R.T., Castillo-Martin M., Cordon-Cardo C., Lunardi A, & Pandolfi P.P. (2015). A genetic platform to model sarcomagenesis from primary adult mesenchymal stem cells. Cancer discovery, 5(4), 396-409.
+ Open protocol
+ Expand
6

ChIP-qPCR analysis of FZD7 regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
HMEC cells (Lonza) or MMTV-Wnt-1 primary cells were grown to 80% confluence and cells were then cross-linked with 1% formaledyde and processed. The crosslinking, immunoprecipitation, washing, elution, reverse crosslinking, and proteinase K treatment were performed according to the manufacturer’s directions described in the Magna ChIP G Chromatin Immunoprecipitation Kit from Millipore. Antibodies used were anti-4A4, H-129 (Santa Cruz) or normal rabbit IgG. Purified immunoprecipitated DNA was used for real time qPCR. Primers for ChIP PCR are: 5′-TATCAGCATTCCAGGCCCAC-3′ (forward) and 5′-TTCCTGGGAGAACAATCGCC-3′ (reverse) for human FZD7; 5′-AATGAGGCAAACACCCCCTC-3′ (forward) and 5′-CTCCGGGGGATTAAAGGTGG-3′ (reverse) for mouse Fzd7; 5′-CGAGATCCCTCCAAAATCAA (forward) and 5′-CCCAGCCTTCTCCATGG (reverse) for human GAPDH and 5′-AACATCAAATGGGGTGAGG-3′ (forward), 5′-GGCCTTCTCCATGGTGGT-3′ (reverse) for mouse Gapdh.
Chakrabarti R., Wei Y., Hwang J., Hang X., Blanco M.A., Choudhury A., Tiede B., Romano R.A., DeCoste C., Mercatali L., Ibrahim T., Amadori D., Kannan N., Eaves C.J., Sinha S, & Kang Y. (2014). ΔNp63 promotes stem cell activity in mammary gland development and basal-like breast cancer by enhancing Fzd7 expression and Wnt signaling. Nature cell biology, 16(10), 1004-13.
+ Open protocol
+ Expand
7

ChIP-qPCR Analysis of CYR61 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP-qPCR was used to detect the histone modification and TF binding at the promoter and enhancer regions of CYR61. As we described before [29 (link)], the ChIP assay was performed using a Magna ChIP™ G Chromatin Immunoprecipitation Kit (Millipore, 17–611) according to the manufacturer’s protocol. ChIP-grade antibodies were as follows: 2 μg anti-RNA polymerase II (Millipore, 05–623), 2 μg anti-H3K27ac (ThermoFisher, 720,096), anti-H3K4me1 (Abcam, ab8895), 2 μg anti-H3K4me3 (Millipore, 17–614), 3 μg anti-CBP (ThermoFisher, PA1–847), and 3 μg anti-FOXA1 (ThermoFisher, PA5–27157). Immunoprecipitated DNA was detected by qPCR and normalized with input DNA. The sequences of the primers are listed in Additional file 1: Table S3.
Xie L., Song X., Lin H., Chen Z., Li Q., Guo T., Xu T., Su T., Xu M., Chang X., Wang L.K., Liang B, & Huang D. (2019). Aberrant activation of CYR61 enhancers in colorectal cancer development. Journal of Experimental & Clinical Cancer Research : CR, 38, 213.
+ Open protocol
+ Expand
8

ChIP-qPCR Analysis of Mouse Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse keratinocytes were obtained from CELLnTEC and grown to 80% confluency in CnT-07CF media (CELLnTEC, Bern). Cells were cross-linked with 1% formaldehyde and processed by the Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore). Antibodies used were RR-14,58 (link) H129 (Santa Cruz, Dallas, TX, USA) and normal rabbit IgG. Purified immunoprecipitated DNA was used for real-time qPCR.
Rizzo J.M., Oyelakin A., Min S., Smalley K., Bard J., Luo W., Nyquist J., Guttman-Yassky E., Yoshida T., De Benedetto A., Beck L.A., Sinha S, & Romano R.A. (2016). ΔNp63 regulates IL-33 and IL-31 signaling in atopic dermatitis. Cell Death and Differentiation, 23(6), 1073-1085.
+ Open protocol
+ Expand
9

Ezh2-Mediated Chromatin Immunoprecipitation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Day 6 uteri from the control and Ezh2 uKO were used. Uterine tissues surrounding the embryos were longitudinally opened at the mesometrial side and kept at −80 °C until use. Endometrial tissues were disrupted with 35 strokes in a Dounce homogenizer on ice, with a loose-fitting pestle in PBS-containing protease inhibitor cocktail and phosphatase inhibitors 2 and 3 (Sigma, St. Louis, MO, USA). After centrifugation with 1000g for 5 min, pellets were received in the nuclei EZ lysis buffer (Sigma) to isolate the nuclei. Native ChIP was then performed as previously described [63 (link)], with some modifications. For the fragmentation, chromatins were treated by 20 U/μl MNase at 37 °C for 5 min. Input DNA was analyzed with a 2100 Bioanalyzer system using High-Sensitivity DNA Reagent kit (Agilent, Santa Clara, CA, USA) to confirm DNA fragmentations at approximately 200–300 bps. Chromatin immunoprecipitation was performed using Magna ChIP G-Chromatin Immunoprecipitation Kit (Millipore, Burlington, MA, USA) following the manufacturer’s protocol. Anti-H3K27me3 antibody (39155, Active motif, Carlsbad, CA, USA) or anti-rabbit IgG (2729, Cell Signaling Technology) was used to precipitate the target chromatins. Chromatin-immunoprecipitated DNAs were purified by extracting phenol–chloroforms.
Fukui Y., Hirota Y., Aikawa S., Sakashita A., Shimizu-Hirota R., Takeda N., Ishizawa C., Iida R., Kaku T., Hirata T., Hiraoka T., Akaeda S., Matsuo M, & Osuga Y. (2023). The EZH2–PRC2–H3K27me3 axis governs the endometrial cell cycle and differentiation for blastocyst invasion. Cell Death & Disease, 14(5), 320.
+ Open protocol
+ Expand
10

Chromatin Immunoprecipitation Protocol for RelA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were grown to 80% confluence, and crosslinking was performed with 1% formaldehyde for 10 min. ChIP assays were performed using a Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore) according to the manufacturer’s instructions. After immunoprecipitation with an antibody to RelA (Cell Signaling Technology, 8242) or normal rabbit IgG, protein-DNA crosslinks were reversed. DNA was then purified to remove the chromatin proteins and analysed by quantitative real-time PCR using the Qiagen EpiTect ChIP qPCR Primers (Cat# GPH1006956(-)01A).
Piao H.L., Yuan Y., Wang M., Sun Y., Liang H, & Ma L. (2014). α-catenin acts as a tumor suppressor in E-cadherin-negative basal-like breast cancer by inhibiting NF-κB signaling. Nature cell biology, 16(3), 245-254.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!