To determine SERPINE1 mRNA expression and protein secretion kinetics, we treated A549 cells or HAE cultures with the following conditions: IFN-β (Abcam) at 1pmol/ml, TGF-β (Abcam) at 1 pg/ml, IAV WSN/33 infection at MOI 1 (A549) or 0.1 (HAE). mRNA levels, normalized to housekeeping gene RPS-11, were determined by qRT-PCR (SuperScript III First Strand Synthesis System, Life Technologies) and SYBR green assay (Roche) as described previously. Primer sequences can be found in Table S3 . Total PAI-1 protein levels from cell supernatants or cell lysates (1% Triton X-100 in PBS, sonication for 10 min) were measured by Human PAI-1 Platinum ELISA (BD Biosciences). mPAI-1 levels from mouse lung homogenates were measured by PAI-1 total mouse ELISA kit (Abcam).
Sybr green assay
Manufactured by Roche
Sourced in Switzerland, United States, Germany
The SYBR Green Assay is a fluorescent dye-based detection method used for quantifying the presence of DNA or RNA in a sample. The dye binds to the minor groove of double-stranded nucleic acids, resulting in an increase in fluorescence that can be measured and correlated to the amount of target present.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Axyprep multisource total rna miniprep kit, by Corning (4 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (4 mentions)
M mlv reverse transcriptase, by Takara Bio (3 mentions)
Rever traace qpcr rt kit master mix with gdna remover, by Toyobo (2 mentions)
Lightcycler 480 system, by Roche (2 mentions)
Ifn β, by Abcam (1 mentions)
Tgf β, by Abcam (1 mentions)
Pai 1 total mouse elisa kit, by Abcam (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Facsaria 2, by BD (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt master mix with gdna remover kit, by Toyobo (1 mentions)
Cdna synthesis kit, by Promega (1 mentions)
Rotor gene 3000 system, by Qiagen (1 mentions)
Total rna kit, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 machine, by Roche (1 mentions)
20 protocols using sybr green assay
1
SERPINE1 Expression and Secretion Kinetics
2
Quantifying Gut Microbiome Composition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The abundance of A. muciniphila in stool samples was quantified by quantitative reverse-transcription polymerase chain reaction (qRT-PCR) in accordance with our previous study.24 (link) Briefly, DNA from the fecal sample is extracted according to the instructions given by the TIANamp Stool DNA Kit,and DNA was stored at −80°C for further analysis. qRT-PCR assay (SYBR Green Assay, Roche, Switzerland) of A. muciniphila was performed on Applied Biosystem. The primers of A. muciniphila were as following, forward CAGCACGTGAAGGTGGGGAC, reverse CCTTGCGGTTGGCTTCAGAT. In addition, the mRNA expressions of microbial enzymes involved in TMA production were also detected by qRT-PCR assay and the primer sequences were listed in supplement table 2. The relative expression levels of DNA and mRNAs were calculated and quantified using the 2−ΔΔCT method after normalization with GAPDH.
3
Isolation and Transcriptional Analysis of iNKT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen tissue cells were recovered and stained with conjugated antibodies targeting CD3 and TCR Vα24; iNKT cells were then isolated by BD FACS Aria II (BD Bioscience, San Jose, CA, United States), and the sorted iNKT cells were stimulated with PMA/Inomycin. Total RNA was extracted from the stimulated cells by using an EZ-press SINGLE Cell to cDNA kit (EZBioscience, Roseville, MN), which could facilitate RNA extraction from low cell numbers. Briefly, the cDNA was pre-amplified using gene-specific primers (Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), T-bet, GATA Binding Protein 3 (GATA3), and RAR Related Orphan Receptor C (RORc)) from the cell lysate, and then, the pre-amplification product was analyzed by quantitative PCR employing the SYBR green assay (Roche, Basel, Switzerland). The relative expression levels of the target genes were normalized to those of GAPDH. The information related to the primers used and presented in Supplementary Table 3
4
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and isolated from the cell lines and frozen tumor specimens using a AxyPrep Multisource Total RNA Miniprep Kit from Axygen (Corning, Suzhou, Jiangsu, China), and the first strand cDNA was synthesized using the Rever TraAce qPCR RT Kit Master Mix with gDNA Remover (FSQ-301, Toyobo Co. Ltd. Osaka, Osaka Prefecture, Japan) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed as previously described [10 (link)]. Briefly, qRT-PCR (SYBR Green Assay, Roche Diagnostics GmbH, Indianapolis, IN, USA) was performed on a 7500 FAST Real-Time PCR System (Applied Biosystems). The relative expression levels of the mRNA were calculated and quantified using the 2−ΔΔT method after normalization to the expression of the control. GAPDH served as the endogenous control. The primer sequences are described in Additional file 2 : Table S2 and were purchased from Comate Bioscience (Institute of Biotechnology, Jilin, China).
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction and reverse transcription were performed as previously described [5 (link)]. qRT-PCR (SYBR Green Assay, Roche, Mannheim, Germany) was performed on Applied Biosystem 7500. Data analysis was performed using the 2−△△CT method. U6 was used as the internal reference for miR-30b-5p, and GADPH was used as the internal reference for CAMKII mRNA. The primer sequences were designed by Primer 5.0 and are listed in Table 1 .
Primer sequence of genes.
| Gene | Primer sequence |
|---|---|
| CAMKII | F: 5′-GACAAGAAAACTCCGCAA-3′ |
| R: 5′-AAATCAACCCCAAAATCC-3′ | |
| GADPH | F: 5′-TGGAGTCTACTGGCGTCTT-3′ |
| R: 5′-TGTCATATTTCTCGTGGTTCA-3′ | |
| miR-30b-5p | F: 5′-ACACTCCAGCTGGGTGTAAACATCCTACAC-3′ |
| R: 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCTGAGT-3′ | |
| U6 | F: 5′-CTCGCTTCGGCAGCACA-3′ |
| R: 5′-AACGCTTCACGAATTTGCGT-3′ |
Primer sequence of CAMKII, GADPH, miR-30b-5p and U6.
F forward primer sequence, R reverse primer sequence.
6
Quantitative Analysis of miR-361-3p and mRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and isolated from cell lines and frozen tumor specimens using AxyPrep Multisource Total RNA Miniprep Kit (Axygen Biosciences, USA) according to the manufacturer’s instructions and the first-strand cDNA was synthesized using the ReverTraAce qPCR RT Kit (FSQ-101, Toyobo Co. Ltd.) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed as previously described47 (link). Briefly, qRT-PCR (SYBR Green Assay, Roche Diagnostics GmbH) was performed on a 7500 FAST Real-Time PCR System (Applied Biosystems). The relative expression levels of miR-361-3p and mRNAs were calculated and quantified using the 2−ΔΔT method after normalization for the expression of the control. U6 and GAPDH served as the endogenous controls, respectively. The primer sequences are described in Supplementary Table S3 and were purchased from Thermo Fisher Scientific and RIBOBIO.
7
Circular RNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, USA) and synthesized into cDNA using M-MLV reverse transcriptase (TaKaRa Bio, Japan) following the manufacturer’s instructions. qRT-PCR was performed using SYBR Green assay (Roche, Switzerland). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and U6 were used as controls. The primer sequences were:
GAPDH-S: 5′-ACACCCACTCCTCCACCTTT-3′
GAPDH-AS: 5′-TTACTCCTTGGAGGCCATGT-3′
Hsa_circ_0000144-S: 5′-GAGTGTTGGCCTGTCCTCAA-3′
Hsa_circ_0000144-AS: 5′-TTGTGCCCAGTTGCCTGTAT-3′
GAPDH-S: 5′-ACACCCACTCCTCCACCTTT-3′
GAPDH-AS: 5′-TTACTCCTTGGAGGCCATGT-3′
Hsa_circ_0000144-S: 5′-GAGTGTTGGCCTGTCCTCAA-3′
Hsa_circ_0000144-AS: 5′-TTGTGCCCAGTTGCCTGTAT-3′
8
Quantitative RT-PCR Assay for Gastric Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human gastric epithelial cell line (GES-1) and GC cell lines (MKN-45 and AGS) were obtained from Tianjin Createch Biotechnology Co. LTD (Tianjin, China). All cells were maintained in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 1% penicillin-streptomycin (Invitrogen) and 10% fetal bovine serum (Invitrogen) at 37 °C and 5% CO2. qRT-PCR was performed according to the method described earlier [17 (link)]. Total RNA was extracted using TRIzol reagent (Invitrogen) and synthesized into cDNA using M-MLV reverse transcriptase (TaKaRa Bio, Japan) following the manufacturer’s instructions. qRT-PCR was performed using SYBR Green assay (Roche, Switzerland). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or U6 was utilized as an endogenous reference. The primers sequences are listed in Supplementary Table S1 .
9
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells and tissues was extracted using the AxyPrep Multisource Total RNA Miniprep Kit from Axygen (Corning, Jiangsu, China). First‐strand cDNA was synthesized by Rever TraAce qPCR RT Master Mix with gDNA Remover Kit (FSQ‐301, FSQ‐101, TOYOBO, Japan). qRT‐PCR was performed as previously described.[42 ] qRT–PCR (SYBR Green Assay, Roche Diagnostics GmbH, USA) was conducted on a 7500 FAST Real‐Time PCR System (Applied Biosystems). The relative expression levels of lncRNAs, miRNAs and mRNAs were calculated using the 2−ΔΔT method. GAPDH and U6 were used as endogenous controls. Some of primer sequences are listed in Supporting Information and others were purchased from Comate Bioscience (Institute of Biotechnology, Jilin, China) and RIBOBIO (Guangdong, China).
10
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with reagent (Axygen, USA) according to the manufacturer’s instructions. The primers used were listed in Supplementary Information. qRT-PCR (SYBR Green Assay, Roche, Switzerland) was performed on Applied Bio-system. The relative expression levels of mRNAs were calculated and quantified using the 2−ΔΔCT method after normalization with GAPDH.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!