Four groups of cells were digested and resuspended with a 200 μl DMEM medium. Four fields of view were randomly selected, and the diameter of 20 cells was measured, and the volume was calculated using the cell image analysis system (CIAS-1000, Daheng, Beijing). The cell suspension was injected into the Transwell cell chamber (3422, Corning), and the cell morphology was observed under an inverted microscope with a magnification of 400 times.
Transwell cell chamber
Manufactured by Corning
Sourced in United States
Transwell cell chambers are a laboratory equipment used for cell culture and migration studies. They consist of a porous membrane insert that separates two compartments, allowing for the co-culture of different cell types or the study of cell migration through the membrane.
Automatically generated - may contain errors
Lab products found in correlation
Rabbit anti human gapdh monoclonal antibody, by Cell Signaling Technology (1 mentions)
Mouse anti human β actin monoclonal antibody, by Cell Signaling Technology (1 mentions)
Qrt pcr primers, by Sangon (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Matrigel, by BD (1 mentions)
Crystal violet, by Merck Group (1 mentions)
Paraformaldehyde (pfa), by Merck Group (1 mentions)
Ix53 inverted fluorescence microscope, by Olympus (1 mentions)
Image pro plus 7, by Media Cybernetics (1 mentions)
Bx53 microscope, by Olympus (1 mentions)
5 protocols using transwell cell chamber
1
Cell Morphology Characterization Protocol
2
LRRC59 Knockdown Modulates Cell Migration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reagents used in this study were Hams F‐12K medium (Wuhan Servicebio), RPMI 1640 medium, and FBS (Gibco). The three groups of LRRC59 interference experimental plasmids with different sequences and one negative control plasmid (Chongqing Baoguang Biotechnology Co., Ltd.) are as follows:
shLRRC59#1:5′‐CCTGGATCTGTCTTGTAATAA‐3′
shLRRC59#2:5′‐GTAATAAACTGACTACTCT‐3′
shLRRC59#3:5′‐GCAGTGTAAGCAGTGTGCAAA‐3′
shLRRC59#NC:5′‐CCTAAGGTTAAGTCGCCCTCG‐3′
Other reagents and instruments included the transfection reagent Lipofectamine3000 (Invitrogen); RNA extraction TRIzol Kit, RNA reverse transcription kit, and quantitative detection kit (TaKaRa); qRT‐PCR primers (Shanghai Sangon Biotech Co., Ltd.); CCK‐8 kit (Chongqing Baoguang Biotechnology Co., Ltd.); transwell cell chamber (Corning); Matrigel (BD); crystal violet staining solution (Chongqing Baoguang Biotechnology Co., Ltd.); rabbit anti‐human LRRC59 polyclonal antibody (ab184143, Abcam); rabbit anti‐human GAPDH monoclonal antibody (2118), and mouse anti‐human β‐actin monoclonal antibody (3700; Cell Signaling Technology); rabbit anti‐human E‐cadherin polyclonal antibody (BS72286), rabbit anti‐human Vimentin polyclonal antibody (BS91440), and rabbit anti‐human Snail polyclonal antibody (BS91262; Bioworld Technology).
shLRRC59#1:5′‐CCTGGATCTGTCTTGTAATAA‐3′
shLRRC59#2:5′‐GTAATAAACTGACTACTCT‐3′
shLRRC59#3:5′‐GCAGTGTAAGCAGTGTGCAAA‐3′
shLRRC59#NC:5′‐CCTAAGGTTAAGTCGCCCTCG‐3′
Other reagents and instruments included the transfection reagent Lipofectamine3000 (Invitrogen); RNA extraction TRIzol Kit, RNA reverse transcription kit, and quantitative detection kit (TaKaRa); qRT‐PCR primers (Shanghai Sangon Biotech Co., Ltd.); CCK‐8 kit (Chongqing Baoguang Biotechnology Co., Ltd.); transwell cell chamber (Corning); Matrigel (BD); crystal violet staining solution (Chongqing Baoguang Biotechnology Co., Ltd.); rabbit anti‐human LRRC59 polyclonal antibody (ab184143, Abcam); rabbit anti‐human GAPDH monoclonal antibody (2118), and mouse anti‐human β‐actin monoclonal antibody (3700; Cell Signaling Technology); rabbit anti‐human E‐cadherin polyclonal antibody (BS72286), rabbit anti‐human Vimentin polyclonal antibody (BS91440), and rabbit anti‐human Snail polyclonal antibody (BS91262; Bioworld Technology).
3
Fibroblast Migration Assay with Irisin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Migration assays were performed using Transwell cell chambers (8 μm pore size; Corning Incorporated, Corning, NY, USA) in 24‐well dishes. Briefly, CFs (104 cells in 200 μl of starvation medium) were adhered to the upper Transwell chamber for 10 hrs at 37°C, and 500 μl of DMEM containing 10% FBS with or without 20 nmol/l irisin was loaded into the lower chamber. CFs were incubated for 10 hrs at 37°C in 5% CO2 and recovered with 4% formaldehyde for 5 min., after which the membrane was stained with 0.1% crystal violet for 30 min. Lastly, the migrated cells in five randomly selected (200×) fields under a microscope were counted.
4
Transwell Assay for HUVEC Migration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs were resuspended in serum-free medium, and 1.0 × 104 cells were loaded into 8.0-μm Transwell cell chambers (Corning, U.S.A.). According to the HUVEC experimental grouping, CM or HG medium (serum-free) were added to the lower chambers. After 12 h of incubation at 37°C and 5% CO2, the culture medium was extracted from the Transwell lower chambers in each HUVEC group and centrifuged for 5 min at 800 rpm. The cells were resuspended in 0.01 mmol/l PBS, and the number of cells in the suspension was counted. The non-migrated cells were removed from the Transwell chambers, and the cells were washed three times with 0.01 mmol/l PBS. HUVECs that migrated to the other side of the membrane were fixed with 4% paraformaldehyde (Sigma, U.S.A.) for 2 h and stained with 1% Crystal Violet (Sigma, U.S.A.). Cell migration was observed with an IX53 inverted fluorescence microscope (Olympus, Tokyo, Japan), and the cell migration rate was calculated at 12 h as follows: [(cells in Transwell cell chamber for 12 h + cells in heavy suspension)/1.0 × 104] × 100% [27 (link)]. Each batch of HUVECs was inoculated in ten wells with three replicates.
5
Transwell Assay for Cell Migration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs were resuspended in Ham’s F12K medium with 1% FBS, and were placed in the upper chamber of 25 mm, 8.0 μm transwell cell chambers (Corning, USA) at 1×104 cells/well. The conditioned medium from each group at different concentrations of JA or JB was added to the lower chambers. The cells were incubated at 37°C in 5% CO2 for 12 h and the residual cells in the transwell chambers were removed and washed 3 times with 0.01 mmol/L PBS. The cells that migrated to the other side of the membrane were fixed with 4% paraformaldehyde (Amquar China Ltd., China) for 6 h and stained with 1% crystal violet (Amquar China Ltd., China), photos were taken using a BX53 microscope (Olympus, Japan), and the cell migration rate at 12 h was measured using Image-Pro Plus 7.0 software (Media Cybernetics, USA) and was calculated as (migrated cells at 12 h/1×104) ×100% [22 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!