Biort cdna first stand synthesis kit

Blood was collected from pigs using anticoagulant EDTA tubes, and peripheral blood mononuclear cells (PBMCs) were isolated from the whole blood with Histopaque-1077(Sigma Inc., USA) according to the manufacturer’s instructions. Briefly, add 5 ml Histopaque-1077 into 50 ml tube, carefully add 5 ml blood onto Histopaque-1077, centrifuge at 400 × g for 30 min, carefully transfer the opaque interface which containing PBMCs into a new tube. Total RNA was isolated from the PBMCs (five transgenic pigs and three wild-type pigs) using the TRIzol-A⁺ reagent (Tiangen, Beijing, China) according to the manufacturer’s instructions. First-strand cDNAs were synthesized from 1 μg of total RNA using a BioRT cDNA first stand synthesis kit (Bioer, Hangzhou, China), and the samples were analyzed with a Bioeasy SYBR green I real-time PCR kit (Bioer, Hangzhou, China). The detection of inflammation mediators were performed using the following primers: pMCP-1 forward (TCACCAGCAGCAAGTGTCCT) and pMCP-1 reverse (ATGTGCCCAAGTCTCCGTTT); pIL-6 forward (TGGGTTCAATCAGGAGAC) and pIL-6 reverse (CTGACCAGAGGAGGGAAT); pTNF-α forward (CGCATCGCCGTCTCCTACCA) and pTNF-α reverse (TGCCCAGATTCAGCAAAGTCCA). The gene expression was normalized against the internal control (β-actin).

Total RNA was isolated with TRIzol-A+ reagent (TIANGEN, Beijing, China) according to the manufacturer's instructions. cDNA was synthesized with DNase I (Fermentas)-treated total RNA using the BioRT cDNA First Stand Synthesis Kit (Bioer Technology, Hangzhou, China). Quantitative real-time PCR was performed using the BioEasy SYBR Green I Real-Time PCR Kit (Bioer Technology, Hangzhou, China) with the Bio-Rad Iq5 Multicolour Real-Time PCR Detection System. Relative gene expression normalized to GAPDH expression was determined by the 2^−ΔΔCT method. All gene expression data were obtained at least three times.
For western blotting, the ear tissues of pup #6 and WT rabbits were homogenized in 150 μL lysis buffer. The protein concentrations were measured by the Braford method (Bio-Rad). An anti-Lamin A/C polyclonal antibody (1:2,000; Proteintech) and an anti-β-actin monoclonal antibody (1:2,000; Proteintech) were used in this experiment.

Total RNA from liver and brain (n = 5) was isolated with TRNzol-A+ reagent (TIANGEN, Beijing, China) according to manufacturer’s instructions. The cDNA was synthesized with DNAse I (Fermentas, Shanghai, China) treated total RNA via the BioRTcDNA First Stand Synthesis Kit (Bioer Technology, Hangzhou, China).
The BioEasy SYBR Green I Real Time PCR Kit (Bioer Technology, Hangzhou, China) was used to perform q-PCR, using the BIO-RAD Iq5 Multicolor Real-Time PCR Detection System. The reaction conditions were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s for DNA denaturation, 60 °C for 15 s for primer annealing, and 72 °C for 30 s for extension. Relative gene expression normalized to β-actin was determined via the 2^−ΔΔCT formula. All experiments on gene expression were performed in triplicate. The gene expression data was presented as mean ± SEM. Primers used for q-PCR and RT-PCR are listed in Table 1.Table 1

Primers for q-PCR and RT-PCR

Gene	Primer sequence (5′ → 3′)	Tann (°C)	Length (bp)
NNAT–RT	F:GCTCATCATCGGCTGGTACA	60	343
	R:CTTGGCAAGTGCTCCTCTGA		262
β-actin-RT	F:ATATCGCTGCGCTGGTCGTC	60	517
	R:AGGATGGCGTGAGGGAGAGC
NNAT-q	F:GTCCCCTGTGTTCCCTCGTC	60	81
	R:TGTCGGTGCTGCTTTTCTGG
Actin-q	F:GGCACCACACYTTCTACAATG	60	133
	R:GGGGTGTTGAAGGTCTCAAAC

T_ann the annealing temperature, RT the primers for RT-PCR, Q the primers for q-PCR