Rna to cdna ecodry premix kit

Manufactured by Takara Bio

Sourced in United States

The RNA to cDNA EcoDry Premix Kit is a laboratory product designed to facilitate the conversion of RNA to complementary DNA (cDNA). The kit provides a pre-mixed, ready-to-use solution that streamlines the reverse transcription process, allowing for efficient and reliable cDNA synthesis from RNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Lightcycler 480, by Roche (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Itaq universal sybr green supermix, by Bio-Rad (1 mentions) Myiq5 icycler, by Bio-Rad (1 mentions) Sybr green master mix, by Roche (1 mentions) Quantinova sybr green rt pcr kit, by Qiagen (1 mentions) Rotor gene q instrument, by Qiagen (1 mentions) Rneasy plant mini kit, by Qiagen (1 mentions) Dnase 1, by Qiagen (1 mentions) Dynamo colorflash sybr green qpcr kit, by Thermo Fisher Scientific (1 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions) Dneasy blood tissue kit 69506, by Qiagen (1 mentions) Vapo protect mastercycler, by Eppendorf (1 mentions) Rnaiso plus reagent, by Takara Bio (1 mentions) Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Sybr green master mix, by Promega (1 mentions) Cfx96 pcr machine, by Thermo Fisher Scientific (1 mentions) Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions) Rneasy plus extraction kit, by Qiagen (1 mentions)

9 protocols using rna to cdna ecodry premix kit

Quantitative RT-PCR Analysis of Drosophila Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from thorax by Trizol. cDNA synthesis was performed using a combination of Oligo-dT and random hexamer priming by the Clontech RNA to cDNA EcoDry Premix Kit. Quantitative RT-PCR was performed using the BioRad iTaq Fast Sybr Green enzyme mix, 10-μl reactions in triplicate, on a Roche Light Cycler 480. Standard curves were generated for targets and normalized with the control gene Actin-5C. t test and SEM. were performed for statistical analysis. ***: p value < 0.001. Primers used in this study:

Actin5C (F): 5′-CTCGCCACTTGCGTTTACAGT-3′, Actin5C (R): 5′-TCCATATCGTCCCAGTTGGTC-3′

Drp1 (F): 5′-GGCCCTAATTCCGGTCATAAA-3′, Drp1(R):5′- CTCTGACTGCCTAGAACAACAA-3′

Car (CG12230) (F) 5′-GATGCACGTTCGCTGAAATAG-3′, (R) 5′-GTCCAGGAAGGAGTGTTTGT-3′

Atg1 (CG10967) (F) 5′-AGCCTGGTCATGGAGTATTG-3′, (R) 5′- GTTGCACGAGGAAGAGTCTAA-3′

Rab7 (CG5915) (F) 5′-CAAACGCTTCTCCAACCAATAC-3′ (R) 5′-AGATCTGCATTGTGACCACTC-3′

VhaAC39-1 (CG2934) (F) 5′-CAGACCCAAGCCTAGATTTCTC-3′ (R) 5′-ACTATGGGTCTCCCGAATACA

Ma P., Yun J., Deng H, & Guo M. (2018). Atg1-mediated autophagy suppresses tissue degeneration in pink1/parkin mutants by promoting mitochondrial fission in Drosophila. Molecular Biology of the Cell, 29(26), 3082-3092.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis from Mouse Knee Joints

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from whole knee joints, to include all structures of the joint above the growth plate, following skin and bulk muscle removal from 2 month old male mice from all genotypes, in a method previously described (11 ). Following snap-freezing by liquid nitrogen, TRIzol reagent (Invitrogen) was used to extract RNA from the tissue. For real-time quantitative RT-PCR (qRT-PCR) analysis, RNA was reverse-transcribed to cDNA using RNA to cDNA EcoDry Premix kit (Clontech Inc., A Takara Bio Company). A Bio-Rad MyiQ™ instrument (BIO-RAD Laboratories Inc. Hercules, CA) using iTaq™ Universal SYBR® Green Supermix (Bio-Rad, CA, USA) was utilized for qPCR. The relative change in mRNA level was normalized to the mRNA level of beta-actin (β-actin), a housekeeping gene, which served as an internal reference for each sample. Table 1 lists the primers, synthesized by IDT (Integrated DNA Technologies, Inc., CA), for the genes of interest.

Burt P.M., Xiao L., Doetschman T, & Hurley M.M. (2018). Ablation of low-molecular-weight FGF2 isoform accelerates murine osteoarthritis while loss of high-molecular-weight FGF2 isoforms offers protection. Journal of cellular physiology, 234(4), 4418-4431.

+ Open protocol

+ Expand

Quantification of CD11c+ DC Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was isolated from purified splenic, lymph node, and tumor CD11c⁺ DCs using the Omega Total RNA Kit according to the manufacturer’s protocol. cDNA was generated using the RNA to cDNA Ecodry Premix Kit (Clontech) according to the manufacturer’s protocol. cDNA was used as a template for quantitative real-time PCR using SYBR Green Master Mix (Roche), and gene-specific primers (19 (link),26 ). PCR analysis was performed using a MyiQ5 ICycler (BioRad). Gene expression was calculated relative to Gapdh.

Hong Y., Manoharan I., Suryawanshi A., Majumdar T., Angus-Hill M.L., Koni P.A., Manicassamy B., Mellor A.L., Munn D.H, & Manicassamy S. (2015). β-catenin promotes T regulatory cell responses in tumors by inducing vitamin A metabolism in dendritic cells. Cancer research, 75(4), 656-665.

+ Open protocol

+ Expand

Quantifying Rice Gene Expression Changes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PROVEAN (Protein Variation Effect Analyzer, v1.0) tool [41 (link)] was used to predict amino acid changes that affected protein function. Total RNA was isolated from the rice grains of Namil and Namil(SA)-flo1 at 12 days after flowering (DAF) using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturers’ instructions. Genomic DNA was removed with DNase I (QIAGEN), and reverse transcription was performed using an RNA to cDNA EcoDry Premix Kit (Clontech, Mountain View, CA, USA). A QuantiNova SYBR Green RT-PCR kit (QIAGEN) and the Rotor-Gene Q instrument (QIAGEN) were used for qRT-PCR with the following conditions: 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 20 s. Fold-change was calculated relative to Namil. Rice Actin 1 (OsACT1; Os03g0718150) was used as an internal control. The primer sequences used for qRT-PCR are listed in Table S1.

Wang H., Ham T.H., Im D.E., Lar S.M., Jang S.G., Lee J., Mo Y., Jeung J.U., Kim S.T, & Kwon S.W. (2020). A New SNP in Rice Gene Encoding Pyruvate Phosphate Dikinase (PPDK) Associated with Floury Endosperm. Genes, 11(4), 465.

+ Open protocol

+ Expand

Quantitative PCR of MUL1 in Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from whole flies using the Macherry-Nagel Nucleospin RNA II kit. cDNA synthesis was performed using the Clontech RNA to cDNA EcoDry Premix Kit, using a combination of Oligo-dT and random hexamer priming. Quantitative PCR was performed using the BioRadiTaq Fast Sybr Green enzyme mix, 10 µl reactions in triplicate, on a Roche Light Cycler 480. Standard curves were generated for MUL1 and two control genes, rpl32 and eIF1α. Table 1.

10.7554/eLife.01958.018

Table 1.

Primer sequences for qPCR

DOI:http://dx.doi.org/10.7554/eLife.01958.018

Primers	Sequence
MUL1-F	GCTATTGGTGAACTGGAGTTGGA
MUL1-R	AGCTTGAGTATCGTCGTTGTCTT
rpl32-F	TATGCTAAGCTGTCGCACAAATG
rpl32-R	GAACTTCTTGAATCCGGTGGGC
eIF1α-F	ACTTCGCAAGAAGGTGTGGATTA
eIF1α-R	GTACGTCTTCAGGTTCCTGGC

Yun J., Puri R., Yang H., Lizzio M.A., Wu C., Sheng Z.H, & Guo M. (2014). MUL1 acts in parallel to the PINK1/parkin pathway in regulating mitofusin and compensates for loss of PINK1/parkin. eLife, 3, e01958.

+ Open protocol

+ Expand

cbsA Mutant Transcriptional Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from Xoo wild‐type and cbsA_ΔFnIII cells using TRIzol reagent (Invitrogen) as per the manufacturer's instructions. The RNA quality was assessed by agarose gel electrophoresis followed by DNase I (NEB) treatment and quantification. Primer pairs were checked for amplification efficiency using 10‐fold dilutions of genomic DNA and the pair that was closest to 100% efficiency (slope of 3.3 for C_t versus log DNA copy number) was picked for further experiments. cDNA was synthesized from 5 µg of total RNA with random hexamers primers using RNA to cDNA EcoDry Premix kit (Clontech). The cDNA was diluted 10 times, and 1 µl of it was subjected to quantitative PCR (qPCR) using a DyNAmo Color Flash SYBR green qPCR kit (Thermo Scientific). The experiment was performed on a ViiA 7 real‐time PCR system (Applied Biosystems). ΔC_t was calculated for Xoo wild type and cbsA_Δ_FnIII by subtracting the C_{t mean} of respective samples from the C_{t mean} of 16S rRNA, which was used as an endogenous control. The experiment was done for three independent biological replicates. Mean ΔC_t and standard error of a representative experiment were plotted.

Nathawat R., Maku R.V., Patel H.K., Sankaranarayanan R, & Sonti R.V. (2022). Role of the FnIII domain associated with a cell wall‐degrading enzyme cellobiosidase of Xanthomonas oryzae pv. oryzae. Molecular Plant Pathology, 23(7), 1011-1021.

+ Open protocol

+ Expand

Confirming Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To confirm expression of mRNA or DNA integration, PCR and RT-PCR were carried out. Genomic DNA was extracted from blood or cells using DNA extraction kit (DNeasy Blood&Tissue kit 69506, Qiagen, Limburg, Netherlands). Total RNAs were extracted using an RNA extraction kit (Easy spin total RNA extraction kit, Cat no. 17221, iNtRON, Seongnam-si, Korea). One ug total RNAs were used for synthesizing cDNA using a cDNA synthesis kit (RNA to cDNA EcoDry™ Premix Kit, PT5153-2, Clontech, California, US). Amplification of the target DNA using specific PCR primers was performed by PCR machine (Eppendorf Vapo Protect Mastercycler, Eppendorf, Germany).

Yum S.Y., Lee S.J., Kim H.M., Choi W.J., Park J.H., Lee W.W., Kim H.S., Kim H.J., Bae S.H., Lee J.H., Moon J.Y., Lee J.H., Lee C.I., Son B.J., Song S.H., Ji S.M., Kim S.J, & Jang G. (2016). Efficient generation of transgenic cattle using the DNA transposon and their analysis by next-generation sequencing. Scientific Reports, 6, 27185.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using RNAiso plus reagent (#9109; Takara Biotechnology, Shiga, Japan) and purified using a RNeasy Plus mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA was reverse transcribed into cDNA using an RNA to cDNA EcoDry premix kit (Takara Biotechnology). Quantitative PCR was performed using a QuantStudio 3 real-time PCR system (Applied Biosystems, Foster City, CA, USA) in 20-μL reactions containing SYBR Green master mix (Promega, Madison, WI, USA) and specific primer pairs (Macrogen, Seoul, Korea). The primer sequences are listed in Table 2. mRNA levels were normalized to that of the housekeeping genes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or beta-actin as indicated in each Figure. Three independent experiments as technical replicates were performed for statistical analyses.

Lee Y.I., Shim J.E., Kim J., Lee W.J., Kim J.W., Nam K.H, & Lee J.H. (2022). WNT5A drives interleukin-6-dependent epithelial–mesenchymal transition via the JAK/STAT pathway in keloid pathogenesis. Burns & Trauma, 10, tkac023.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using the RNeasy Plus extraction kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions. To minimize variability in transcript levels, cells were immediately lysed and processed for RNA extraction following mechanical stress application. Equal amounts of total RNA were used for cDNA generation using the RNA to cDNA EcoDry Premix kit (Takara, San Jose, CA, USA). Real-Time quantitative PCR to access transcript levels was performed in a BioRad CFX96 PCR machine using FAST SYBR Green Master Mix (Applied Biosystems, Waltham, MA, USA) and specific primers for each gene (Table S1).

Pandya M., Gopinathan G., Tillberg C., Wang J., Luan X, & Diekwisch T.G. (2022). The Hippo Pathway Effectors YAP/TAZ Are Essential for Mineralized Tissue Homeostasis in the Alveolar Bone/Periodontal Complex. Journal of Developmental Biology, 10(1), 14.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!