Control shrna sh ctrl lentivirus particles

The liver cancer cell lines HepG2, Huh7, Hep3B, LM9, Bel-7402 and SMMC-7721 were cultured as described previously [33 (link)]. Normal human hepatocytes were isolated from specimens obtained from patients undergoing hepatic resections for the therapy of hepatic tumors after informed consent and according to the rules of the ethics committee of the Second Military Medical University. The liver cancer cells and normal human hepatocytes were cultured in high glucose-containing Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS, 100 units/ml penicillin and 100 μg/ml streptomycin.
Sh-lincRNA-p21 and control shRNA (sh-Ctrl) lentivirus particles were purchased from GenePharma. The shRNA sequences targeting lincRNA-p21 is shown in Supplementary Table S2. Lentivirus expressing human lincRNA-p21 was generated by sub-cloning mouse lincRNA-p21 cDNA to the pSLIK lentivirus expression system (cloning primer forward: TGGCAGTCTGACCCACACTCCCCACGCCC; reverse: ACAGTGCACAGACAATCATACACACGTGT). For retroviral packaging, 293T cells were co-transfected with the retroviral particles. For transduction, cells were incubated with virus-containing supernatant in the presence of 8 mg/ml polybrene. After 48 hours, infected cells were selected for 72 hours with puromycin (2 mg/ml) or hygromycin (200 mg/ml).

Sh-JMJD2A and control shRNA (sh-Ctrl) lentivirus particles were purchased from GenePharma. The sh-JMJD2A sequence is: 5′-GCCACGAGCATCCTATGATGA-3′. Lentivirus expressing human JMJD2A was generated by sub-cloning human JMJD2A cDNA (NM_014663.2) to the pSLIK lentivirus expression system. For lentiviral packaging, HEK293T cells were co-transfected with the lentiviral particles. For transduction, cells were incubated with virus-containing supernatant in the presence of 5 µg/ml polybrene. After 48 h, infected cells were selected for 72 h with puromycin (2 µg/ml).