The largest database of trusted experimental protocols

Mission plko 1 puro empty vector control plasmid dna

Manufactured by Merck Group

The MISSION pLKO.1-puro Empty Vector Control Plasmid DNA is a laboratory tool designed for use in lentiviral-based gene expression and RNA interference (RNAi) experiments. It serves as a negative control for validating the specificity of experimental results obtained using MISSION lentiviral shRNA or overexpression constructs. The plasmid does not contain any shRNA or transgene, allowing it to be used as a baseline for comparison in experiments.

Automatically generated - may contain errors

4 protocols using mission plko 1 puro empty vector control plasmid dna

1

PARP-1 Knockdown in miR-223 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
For genetic knockdown of PARP-1 in vivo, 50 μl of saline-formulated high-titer lentiviral shRNA specifically inhibiting PARP-1 (formulated high-titer lentiviral shRNA specifically inhibiting PARP-1, “PARP-1 shRNA”; Sigma-Aldrich) or control lentivirus (empty vector control plasmid DNA that contains no shRNA insert; MISSION pLKO.1-puro Empty Vector Control Plasmid DNA; Sigma-Aldrich) was administered 72 hours before VILI into male miR-223 knockout mice by an intratracheal injection.
+ Open protocol
+ Expand
2

Cloning of gls1-shRNA Lentiviral Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
MISSION® pLKO.1-puro empty vector control plasmid DNA (Sigma Aldrich) was used for this cloning. We designed two gls1-shRNAs as followings and cloned them into the empty vector following the manufacturer’s protocols. Following oligonucleotide sequences were used for this cloning; 5’- CCGGGAGGGAAGGTTGCTGATTATACTCGAGTATAATCAGCAACCTTCCCTCTTTTTG −3’ and 5’- AATTCAAAAAGAGGGAAGGTTGCTGATTATACTCGAGTATAATCAGCAACCTTCCCTC −3’ for gls1-shRNA1, and 5’- CCGGATCTCGACGGGTTGCTATAATCTCGAGATTATAGCAACCCGTCGAGATTTTTTG −3’and 5’- AATTCAAAAAATCTCGACGGGTTGCTATAATCTCGAGATTATAGCAACCCGTCGAGAT −3’ for gls1-shRNA2. Sequences of cloned vectors were verified (Genewiz). MISSION® pLKO.1-puro non-mammalian shRNA control plasmid DNA control-shRNA (Sigma Aldrich) was used for control shRNA. Those vectors were transfected to 40% confluent HEK-293T cells by polyethyleneimine ‘Max’ (Polysciences, Inc.) according the manufacturer’s protocol. Culture media with shRNA contained-lentiviral particles was collected on day 4 (5 (link)).
+ Open protocol
+ Expand
3

Lentiviral Transduction of NRF2 shRNA in EP-MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To obtain lentiviral particles with shNRF2, HEK293T cells were seeded in 100 mm culture dishes at a density of 3 × 106 cells per dish. On the next day, the cells were transfected with lentiviral particles with either a nontargeting shRNA expression plasmid (MISSION Plko.1-puro Empty Vector Control Plasmid DNA, Sigma) or two shNRF2 expression plasmids (NFE2L2 MISSION shRNA Stock, TRC numbers: TRCN0000007555 (shNRF-1), TRCN0000007558 (shNRF-2), Sigma) with the Delta 8.9 plasmid (gag, pol, and rev genes) and VSV-G (envelope plasmid, Sigma) using Lipofectamine 2000 (Invitrogen). After 6 h of transfection, the medium was replaced. The shRNA-transfected HEK293T cells were maintained for 2 days, and then the supernatants were collected and stored at −70 °C. To knockdown NRF2 in EP-MSCs, the cells were seeded in 6-well plates at a density of 5 × 104 cells per well. After 48 h of infection, the medium was replaced with freshly prepared medium with 10 μg/ml puromycin dihydrochloride (Sigma), and the cells were maintained for 7 days. The knockdown efficiency of the selected cells was analyzed by western blot analysis. Below is a list of shRNAs targeting NRF2 used in this study.
1. shNRF2-1 (region: 3′ UTR)
5′-CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTT-3′
2. shNRF2-2 (region: CDS)
5′-CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTT-3′
+ Open protocol
+ Expand
4

Lentiviral Transduction of Prostate Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC3, DU145 and LNCaP prostate cancer cell lines were seeded in a 96 multiwell, 35,000 cells/ well, and treated with Sh MIMIC Lenti miR-423-5p lentiviral particles (GE Healthcare Dharmacon V1SMHS_000254) at 2.5, 5, 10 and 20 MOI. Control empty backbone cells were obtained using lentiviral particles generated from the pLKO.1 Empty plasmid (MISSION® pLKO.1-puro Empty Vector Control Plasmid DNA Sigma Aldrich SHC001). Hexadimethrine Bromide (SIGMA H9268-5G) was used in complete growth media for each cell line to facilitate the infection. After 16 h incubation, infection media was removed and substituted with complete growth medium for each cell line. Puromycin (INVIVOGEN) was then added to each cell complete growth medium at a final concentration of 1 μg/ml for the selection. The lentiviral particles used to infect DU145, PC3 and LNCaP were produced according to the manufacturer’s recommendations. The lentiviral packaging mix was also purchased from Sigma (SHP001).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!