Sirna wizard v3

Three small interfering (siRNA) sequences targeting NDUFAB1 or GABRA1 gene were designed using an InvivoGen siRNA Wizard v3.1 and the most effective siRNA was screened out as we previously reported [8 (link), 89 (link)]. After lentiviral expression vector pLVX-shRNA2-NDUFAB1 or -GABRA1 carrying the specific siRNA was constructed, GCs were then transfected with the NDUFAB1 shRNA or GABRA1 shRNA lentivirus in 24-well plates (2 × 10⁵ cells/well), respectively; and incubated at 37 °C with 5% CO₂. After 24 h of culture, the GCs were collected for EdU cell proliferation and cell apoptosis assay, and lysed for Western blotting and RT-qPCR analysis. The sequence information of NDUFAB1 shRNA, GABRA1 shRNA, shRNA negative control and the frame of lentiviral vectors was shown in Table S2. The most effective siRNA sequences were listed as below: NDUFAB1 siRNA 5′-CCACAAGAGAUAGUAGAUUTT-3′; GABRA1 siRNA 5′- GCAGAAUGUCCAAUGCAUUTT-3′. Scrambled siRNA was used as the negative control siRNA: 5′- UUCUCCGAACGUGUCACGUTT-3′, which was synthesized by Genepharma (Shanghai, China).

We used previously published short interfering RNA (siRNA) against the MYB gene [45 (link)]; appropriate sequences of the control scrambled RNA (scrRNA) were obtained by the InvivoGen siRNA Wizard v3.1 tool (Table S1). Single-stranded RNAs were commercially synthesized (“DNK-syntez”, Moscow, Russia) and annealed as previously described [46 (link)]. For c-Myb knockdown, 2.5 mln cells were transfected by electroporation (as described above) with 500 pmol c-Myb-specific siRNA or scrRNA duplexes. Cells were cultured for 48 h and then were transfected with 5 μg of test vectors, 0.5 μg of pRL-CMV control, and 300 pmol more of siRNA or scrRNA. Luciferase reporter assay was conducted after cell cultivation for 24 h.

Nucleotide sequences to be used for siRNA design were determined using transcript sequences obtained above. Only nucleotide sequences that were conserved across all protein isoforms for our gene of interest and were present in the open reading frame of the gene were used in the design. The nucleotide sequences were evaluated using three siRNA design algorithms (chosen for their ease of use and return of multiple recommendations):

Designer of Small Interfering RNA (DSIR) [28 (link),29 ];

Life Technologies BLOCK-iT RNAi Designer [30 ];

InvivoGen siRNA Wizard v3.1 [31 ].

The length of the siRNA was set to be 19 nucleotides, and siRNAs were selected for further review if they appeared on at least two of the three websites. Selected siRNAs were then screened for off-target effects using the Bowtie Search function on the Maverix browser. siRNAs were discarded if 18 or 19 nucleotides matched with an off-target sequence or if there was a continuous stretch of 16 or more nucleotides that matched with an off-target sequence. Four siRNAs that met these criteria were ordered for knockdown testing in cells.

To synthesize and validate siRNAs that target Pdlim5 or PalmD, we first identified corresponding 19-nucleotide target sequences using the siRNA Wizard v3.1 tool from InvivoGen. Two siRNAs were selected for each target to enable the generation of siRNAs. The siRNA sequences for Pdlim5 were 5′-GCACUGUAUUGUGAGCUAUtt-3′ and 5′-CAACUGUGCUCACUGCAAAtt-3′, while for PalmD they were 5′-GCAUCAGGCAGAACGAAUAtt-3′ and 5′-CGAGGAUAUCUAUGCUAAUtt-3′.
siRNAs for Pdlim5 and PalmD were purchased from Life Technologies. Individual siRNAs were transfected into hippocampal neurons using the manufacturer’s Lipofectamine 2000 protocol. Neurons were allowed to grow for 24–48 h before conducting immunofluorescence assays. Knockdown efficiency of each siRNA was assessed using immunocytochemistry with anti-Pdlim5 or anti-PalmD primary antibodies, and IMARIS software was used to quantify the intensity of immunostained images. Sholl analysis was used to assess the impact upon neuronal morphology (see below).

Targeting sequences for mouse Ask1 (GGAAGGATGAAGATTGAAACT) was identified with the siRNA Wizard v3.1 (InvivoGen). The Ern1/Ire1a (GCTCGTGAATTGATAGAGAA) target sequence was previously described in.^{53 (link)} The targeting sequences were cloned into the pRSI12-U6-(sh)-HTS4-UbiC-TagRFP-2A-Puro (Cellecta) plasmid according to manufacturer’s instructions and verified by sequencing. These vectors were transiently transfected into HEK293T cells along with the packaging vector psPAX2 (Addgene plasmid 12259) and the VSV-G encoding plasmid pMD2.G as previously described.^{54 (link)} The supernatant was harvested 48 h after transfection and viruses were concentrated by ultracentrifugation and resuspended in Opti-MEM medium (Thermo Fisher).

Human desmoplakin siRNA sequences were taken from Wan et al. [29] and are as follows: DP sense AACCCAGACUACAGAAGCAAU, DP antisense AUUGCUUCUGUAGUCUGGGUU (Dharmacon, Chicago, IL). Using Invivogen siRNA wizard v3.1 blast search, scrambled DP sequences were designed and are as follows: scrambled DP sense GCAGAACAACGCAUCAACAUA, scrambled DP antisense UAUGUUGAUGCGUUGUUCUGC (Dharmacon). HaCaT cells were seeded in 6-well plates at 50,000 cells/cm² in NCM for 24 hours. They were then incubated in serum-free DMEM for 2 hours prior to transfection and oligonucleotides transfected at 50 nM using 2 µg/ml Lipofectamine 2000 (Life Technologies) diluted in serum-free DMEM. At 24 hours post-transfection the cells were either treated with LCM for 1 hour and stained for immunoflourescence or lysed in DTT sample buffer and immunoblotted to assess knockdown efficiencies.