X tremegene sirna transfection regent

Mouse ARRB2 mRNA was cloned from cDNA of mouse lung tissue by PCR, the primers containing NheI restriction site in the sense oligo and HindIII restriction site in the antisense oligo (Sense: 5’- CTAGCTAGCATGGGAGAAAAACCCGGGAC -3’; Antisense: 5’- CAGAAGCTTCTAGCAAAACTGGTCATCACAGTC-3’; TsingKe, Beijing, China). To construct ARRB2-overexpression vector, the gene were cloned into the multiple cloning site of NheI- HindIII double digested pcDNA3.1 plasmid (Invitrogen, CA, USA). To knock down the expression of ARRB2, the siRNA was purchased from TsingKe (Sense: 5’- GGACCAGGGUCUUCAAGAATT -3’; Antisense: 5’- UUCUUGAAGACCCUGGUCCTT-3’). For the ARRB2 overexpression or knockdown assay, the pcDNA3.1-ARRB2 plasmid (1μg) and ARRB2-siRNA (130ng) were transfected into MLE-12 cells by X-tremeGENE siRNA Transfection Regent (Roche) in Opti-MEM (Gibco). After 24h transfection, the transfected cells were treated with IL-17 (10ng/ml) for 3 hours and examined by qRT-PCR and Western blot.

Bicinchoninic acid (BCA) protein assay kit (P0009), LDH cytotoxicity assay kit (C0016), enhanced chemiluminescence (ECL) kit (P0018M), MTT cell proliferation and cytotoxicity assay kit (C0009), Hoechst staining kit (C0003), benzyloxycarbonyl-Val-Ala-Asp fluoromethylketone (Z-VAD) (C1202), were obtained from Beyotime Institute of Biotechnology (Haimen, Jiangsu, China). Glutathione (GSH) assay kit was obtained from Nanjing Jiancheng Bioengineering Institute (Jiancheng, Nanjing, Jiangsu, China). Hydrogen peroxide (H₂O₂) and 3-methyladenine (3-MA) were obtained from Sigma-Aldrich (St. Louis, USA). Rabbit monoclonal anti-caspase-3 (cleaved) antibody was obtained from Beyotime Institute of Biotechnology. Rabbit polyclonal anti-LC3B antibody and horseradish peroxidase (HRP)-conjugated goat anti-rabbit or -mouse secondary antibodies were purchased from Sigma-Aldrich. Mouse monoclonal anti-β-actin antibody and rabbit polyclonal anti-ATG5 antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, USA). X-tremeGENE siRNA transfection regent was from Roche (Basel, Switzerland).

After 24 h of starvation with HITES medium containing 0.1% FBS, MLE-12 cells were cultured with different concentrations (0, 1, 10 and 100ng/ml) of mouse recombinant murine IL-17A (R&D Systems, Minneapolis, USA) for 24h, and the expression of miR-365-3p was examined by qRT-PCR. Alternatively, the mimic (100nM) of miR-365-3p was transfected into the MLE-12 cells using X-tremeGENE siRNA Transfection Regent (Roche, Penzberg, Upper Bavaria, Germany) in Opti-MEM (Gibco) for 24h. Expression of ARRB2 was examined by qRT-PCR and Western blot.
We cultured 4 kinds of cells for MiR-365-3p transfection, including MLE-12, J774a.1, U937 and A549. the cells were transfected with the mimic (100nM) of miR-365-3p for 6h, and 24h later, the transfected cells were incubated with 10ng/ml murine IL-17A or 100 ng/ml human IL-17A (R&D Systems). RNA samples were collected 3h after the IL-17A stimulation. qRT-PCR were performed to evaluate the level of cytokines in IL-17A treated cells.