Usingssoadvanced universal sybr green supermix

Whole-colon tissue from P7 pups was collected, trimmed of mesentery and
flushed gently with ice-cold PBS to remove colon contents. Tissue was then
placed in 1 ml of QIAzol (Qiagen) and homogenized using PowerGen500 (Fisher).
RNA was extracted using the RNeasy Mini kit (Qiagen) according to the
manufacturer’s instructions, including on-column DNase digestion. RNA
(500 ng) from each sample was used as a template for cDNA synthesis with iScript
supermix (Promega), and the reaction was then diluted fivefold in DNase-free
water. Triplicate 10-μl reactions (1× supermix, 300 nM forward and
reverse primers, 5 μl of cDNA) were carried out on CFX96 (Bio-Rad) using
SSOAdvanced Universal SYBR Green Supermix (Bio-Rad) under the following reaction
conditions: 95 °C for 1 min followed by 39 cycles of 95 °C for 5 s
and 60 °C for 30 s. Relative qPCR expression was analyzed using the
average threshold cycle from triplicate wells for each gene of interest compared
to the threshold cycle for hprt1 in the same sample, calculated
as 2^{^}(Ct_hprt1−Ct_GOI).

For gene expression analysis of mouse or human CD8⁺ T cells by RT-qPCR, cells were lysed in RLT buffer and RNA was isolated via the RNeasy Mini isolation kit (Qiagen), according to the manufacturer’s instructions. After RNA concentration and purity were checked using a nanodrop, 100 ng RNA per reaction was subsequently converted to cDNA using the SuperScript VILO cDNA synthesis kit (Invitrogen). Samples were assayed using
SsoAdvanced Universal SYBR Green Supermix (Bio-rad), and kinetic PCR was performed on a CFX Connect Real-Time PCR Detection System (Bio-rad). The indicated genes were analyzed by using the primers listed below. Data was normalized to the housekeeping gene Valosin-containing protein (VCP) and hypoxanthine guanine phosphoribosyltransferase (HPRT). Relative transcript levels were analyzed using the 2(^{− ΔΔCt}) method. Target(Forward/Reverse);HuSt3gal1(GCATTTCTCTTTCCCACAGC/CTAATTCCCAGCCACCTTCA),HuSPC24(GGGATTATGAGTGTGAGCCAGG/ACTCCAGAGGTAGTCGCTGATG),HuVCP(AGGATGATCCAGTGCCTGAGAG/GGAATCTGAAGCTGCCAAAG),MoSt3gal1(GCAGACGTTGGGAGCCGGAC/GGCACGGGGACATAGGTGTGAG),MoSPC24(CAGTGGGATTATGAATGCGAGCC/GGTAGTCACTGATGAACTTCGGC),MoHPRT(GCTGGTGAAAAGGACCTCT/CACAGGACTAGAACACCTGC).

RNA isolation was done using TRIzol (Ambion, 15596–026) as
per standard protocol followed by DNase treatment using Turbo DNA-free kit
(Life Technologies AM1907). SuperScript III Reverse Transcriptase
(ThermoFisher Scientific, 18080–093) was used for cDNA synthesis as
described (Moon et al., 2015 (link)). qPCR
was performed in CFX96 Real-Time PCR detection system (Bio-Rad) using
SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, 172–5274). POLR2A
was used for the normalization and quantification. Graphing and statistical
analysis of qPCR results were performed using GraphPad Prism. Primers used
are given in Table
S1.