Ideal chip seq kit

K562 cells were fixed in 1% paraformaldehyde for 8 minutes, and ChIP was performed using the iDeal ChIP-seq kit (Diagenode, Liege, Belgium) according to the manufacturer’s instructions. Chromatin extracts from one million cells were sonicated to yield 100 to 500 bp fragments using a Bioruptor™ Plus (Diagenode) on high power for two rounds of 12 cycles with 30s on 30s off at 4°C. Antibodies used in ChIP were as follows; CHD1 - 3 μl per reaction of #4351 (Cell Signalling Technology, Danvers, MA, USA), CHD2 - 3 μl per reaction of ab68301 (Abcam, Cambridge U.K.), H3 - 2 μl per reaction of ab1791 (Abcam, Cambridge U.K.), and H3.3 - 3 μl per reaction of 09–838 (Millipore, Solna, Sweden). Primers for qPCR were designed across DNase hypersensitivity sites at TSS regions, intergenic or intragenic regions, or active tRNA loci and are listed in Additional file 7: Table S2.

Primary HDFs overexpressing ANKRD1 were previously cross-linked for protein-protein interactions with Ethylene glycol bis(succinimidyl succinate) (EGS) at a final concentration of 1.5 mM for 30 minutes. Formaldehyde was added to a final concentration of 1% for 10 min at RT. The reaction was quenched using the addition of glycine (final concentration 125 mM). Cells were washed with ice-cold PBS and collected by centrifugation (400 g). Next, cells were lysed using the iDeal ChIP-seq kit (DIAGENODE) for Transcription Factors according to the manufacturer’s instructions. DNA in the cross-linked chromatin was fragmented by sonication to a 100-300 bp range using Diagenode Bioraptor. Samples were precleared using the beads included in the kit and incubated overnight at 4 °C with 5 µg of 10 µl of commercially available V5 tag antibody from GENETEX targeting the V5 tag in ANKRD1 expressing fibroblasts. Non-immune controls with non-immune IgG were included. Antibody–chromatin complexes were pulled down using protein A-beads from the kit (DIAmag protein A-coated magnetic beads, DIAGENODE). Elution was performed according to the manufacturer’s instructions. Chromatin was quantified using the Qubit Fluorometric Quantification Kit (ThermoFisher Scientific).

Confluent HF cells were infected with AD169 WT, TB40E WT, and TB40E ΔUL84 (MOI = 4). After 20 hpi or 3 dpi, ChIP was performed using Diagenode iDeal ChiP-seq kit for transcription factors according to the manufacturer’s protocol (Diagenode, catalog no. C01010055). Immunoprecipitation reaction mixtures were incubated overnight with 5 μl of UL84 antibody, IE2 antibody, or IgG control antibody. Purified DNA was quantified using the Qubit dsDNA high-sensitivity assay (Thermo Fisher). Libraries were created from ChIP DNA and input DNA samples using the NEXTflex Illumina ChIP-seq library preparation kit (Bioo Scientific, catalog no. 5143-01). Libraries were sequenced with Illumina NextSeq 500/550 mid output kit v2 at the Nevada Genomics Center. ChIP-seq data analysis was performed using Qiagen CLC genomics workbench. Parameters for analysis include the following: reference GU179289.1, no masking, mismatch cost of 3, cost of insertions and deletions equal to linear gap cost, insertion/deletion cost of 3, insertion/deletion open cost of 6, insertion/deletion extend cost of 1, length fraction of 0.8, similarity fraction of 0.9, and nonspecific match handling set to map randomly. Raw data from the ChIP analysis have been deposited in NCBI’s Gene Expression Omnibus (GEO) and are accessible with the following GEO series accession number (GSE): GSE169634.

Chromatin immunoprecipitation (ChIP) was performed using the iDeal ChIP-seq kit (Diagenode, Denville, NJ, USA) according to the manufacturer’s instruction with minor modifications. Briefly, 2 × 10⁶ PH₃-treated or untreated cells were harvested in PBS and cross-linked with formaldehyde (1%) for 2 min. After sonication, chromatin from 1 × 10⁶ cells was subjected to ChIP with Pol II antibody (ab5408; Abcam, Cambridge, MA, USA). For ChIP-qPCR assays, four pairs of primers were used to amplify fragments at different distances downstream from the DREF transcription start site (TSS) (Table 3). Pol II enrichment was normalised to the constitutively active glyceraldehyde-3-phosphate dehydrogenase promoter region using the Drosophila Positive Control Primer Set Gapdh1 (Active Motif, Carlsbad, CA, USA).Table 3

Primers for chromatin immunoprecipitation (ChIP)-qPCR.

Primer name	Sequence 5′–3′
DREF-0-ChIP-S	CAAACAAGAAGATCCCAATC
DREF-0-ChIP-R	TCCAAAGTAGCGCCAGTA
DREF-250-ChIP-S	CATCTCCAGCACCGACAC
DREF-250-ChIP-R	AATGAACTCCAGTTTGACCC
DREF-500-ChIP-S	AACCACGATAACGCTTCCG
DREF-500-ChIP-R	CGCTCCTCCTCCTCTACCA
DREF-1000-ChIP-S	CGCTTCCTTAGCATCTTC
DREF-1000-ChIP-R	CCTCTTCCTCGTCGTAGTT

Confluent HF cells were infected with AD169 WT, TB40E WT, and TB40E ΔUL84 (MOI = 4). After 20 hpi or 3 dpi, ChIP was performed using Diagenode iDeal ChiP-seq kit for transcription factors according to the manufacturer’s protocol (Diagenode, catalog no. C01010055). Immunoprecipitation reaction mixtures were incubated overnight with 5 μl of UL84 antibody, IE2 antibody, or IgG control antibody. Purified DNA was quantified using the Qubit dsDNA high-sensitivity assay (Thermo Fisher). Libraries were created from ChIP DNA and input DNA samples using the NEXTflex Illumina ChIP-seq library preparation kit (Bioo Scientific, catalog no. 5143-01). Libraries were sequenced with Illumina NextSeq 500/550 mid output kit v2 at the Nevada Genomics Center. ChIP-seq data analysis was performed using Qiagen CLC genomics workbench. Parameters for analysis include the following: reference GU179289.1, no masking, mismatch cost of 3, cost of insertions and deletions equal to linear gap cost, insertion/deletion cost of 3, insertion/deletion open cost of 6, insertion/deletion extend cost of 1, length fraction of 0.8, similarity fraction of 0.9, and nonspecific match handling set to map randomly. Raw data from the ChIP analysis have been deposited in NCBI’s Gene Expression Omnibus (GEO) and are accessible with the following GEO series accession number (GSE): GSE169634.

HCT116 cells and RKO cells were fixed in 1% paraformaldehyde for 8 min, and ChIP was performed using the iDeal ChIP-seq kit (Diagenode, Liege, Belgium) according to the manufacturer’s instructions. Chromatin extracts from one million cells were sonicated to yield 100 to 500 bp fragments using a Bioruptor Pico sonication device (Diagenode) on high power for two rounds of 6 cycles with 30 s on 30 s off at 4 °C. Fragmentation was verified with agarose gel electrophoresis. ChIP-seq was performed using 1 μg of H3K4me1 antibody (ab8895, Abcam) per ChIP. After reverse cross-linking overnight at 65 °C, DNA was extracted using the Qiagen MinElute PCR purification kit in 15 μl of elution buffer. Libraries were prepared for sequencing using the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® and sequenced on a HiSeq 2500 System (Illumina).

CLL cells were isolated as described above and were stimulated for 16 h with PMA (20 ng/ml, Sigma Aldrich) and ionomycin (0.75 µg/ml, Sigma Aldrich). Cells were fixed with 1% formaldehyde for 5 min and fixation was stopped by the addition of 10% glycine. The chromatin immunoprecipitation was performed using the iDEAL ChIP seq kit (Diagenode, C01010055) according to the manufacturer’s instructions. The obtained chromatin was sheared to yield 200–500 bp DNA fragments with the focused ultrasonicator M220 (Covaris) and the magnetic immunoprecipitation was performed using the following antibodies: 10 µg NFAT2 (7A6) (Abcam) and 2 µg IgG (DA1E) (Cell signalling). With the immunoprecipitated DNA, a qPCR was performed using SYBR Select Mastermix (Invitrogen) in a LC480 Lightcycler (Hoffmann-La Roche). The number of immunoprecipitated regions for each target gene (CD40L and LCK) was calculated using different dilutions of input DNA. The primers used for the CD40L and LCK promotor region were synthesised by Sigma Aldrich (Supplementary Table 3).