RNA was collected after the indicated time-points and qPCR was performed using Power Sybr mix (ABI) on a CFX96 Real-time thermal cycler (Bio-Rad). Total RNA was extracted using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol. cDNA was prepared from 1 μg RNA using Maxima reverse transcriptase (Fermentas) following the manufacturer’s protocol. qPCR was performed in triplicate in 10 μL reactions with Power Sybr mix (ABI) using Qiagen quantitect primers for B2M, ACTB, CCNB1, CDC25B, and FOXM1 and additional primers shown below. ACTB and B2M were used as housekeeping genes for normalization of the data. PCR conditions were: 95 °C 10 min, 40 cycles of 95 °C for 15 s, and 60 °C for 30 s followed by a dissociation curve (60–95 °C). Relative expression levels were calculated using the delta delta CT method [68 (link)].
Power sybr mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
Power SYBR Mix is a ready-to-use solution for real-time PCR applications. It contains a DNA polymerase, SYBR Green dye, and necessary buffer components for efficient amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Quantitect primer, by Qiagen (1 mentions)
Maxima reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time thermal cycler, by Bio-Rad (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
7300 real time pcr detection system, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Steponeplustm real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript cdna synthesis kit, by Takara Bio (1 mentions)
Iscript reaction mix kit, by Bio-Rad (1 mentions)
Rneasy plus universal kit, by Qiagen (1 mentions)
Ultra turrax disperser, by IKA Group (1 mentions)
Mxpro qpcr software, by Agilent Technologies (1 mentions)
Blood and tissue mini kit, by Qiagen (1 mentions)
Mxpro3005p real time pcr system, by Agilent Technologies (1 mentions)
Nanophotometer, by Implen (1 mentions)
7 protocols using power sybr mix
1
qPCR Analysis of Cell Cycle Genes
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from aortic tissues or RAW264.7 cells was extracted with TRIzol reagent (Invitrogen, 15596018). Real-time PCR samples were prepared by mixing cDNAs, power-SYBR Mix (ABI, A25742) and specific primer sets (Supplementary Table 1 ). The initial denaturation step of PCR amplification was 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 55°C for 1 min, then 95°C for 15 s and 60°C for 1 min, and last at 95°C for 1 s. Gene expressions were normalized against Gapdh.
3
Quantitative Analysis of Zebrafish mib2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained using RNAiso Plus (TaKaRa Bio, Japan) according to the manufacturer's protocol. Total RNA was reverse transcribed using ReverTra Ace (TOYOBO) according to the manufacturer's protocol. The zebrafish mib2 gene sequence was retrieved from the UCSC Genome Browser for real time PCR (http://genome.ucsc.edu/cgi-bin/hgGateway ). The primers were designed by Primer3web version 4.0.0 (http://primer3.ut.ee/ ). Primer specificity was confirmed by NCBI/Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ). The transcript levels of mib2 and Rpl13α were quantified by real-time PCR with Power SYBR Mix (Applied Biosystems) on a 7300 Real-Time PCR detection system (Applied Biosystems) as described previously (Itoh et al., 2014 (link)).
4
Optimized RT-qPCR Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RT-qPCR assays were performed in 96-well plates using the StepOnePlusTM Real Time PCR System (Applied Biosystems, Foster City USA). All cDNAs were diluted 1:25 to serve as a template for the reactions. Each RT-qPCR reaction contained 5 µl Power SYBR Mix (Applied Biosystems, Foster City, USA), 2 µl of the diluted cDNA, 4 pmol of each of forward and reverse gene-specific primers and ultrapure water up to 10 µl. RT-qPCR reactions were performed as follow: one step thermal cycle of 2 min at 95 °C, and then 40 cycles of 30 s at 95 °C and 30 s at 60 °C. A melting curve analysis was carried out to assess primer specificity and product quality by step-wise denaturation of the PCR product with the following conditions: a final step of 15 s at 95 °C, 1 min at 60 °C and then the fluorescence measured from 60 to 95 °C at each 0.7 °C increment of temperature.
The experiment was performed using biological triplicate samples for each condition tested. Two technical replicates were used for each biological replicate and the average Cq values (Cycle quantification) were used for quantification.
The experiment was performed using biological triplicate samples for each condition tested. Two technical replicates were used for each biological replicate and the average Cq values (Cycle quantification) were used for quantification.
5
Quantitative PCR Analysis of Dermal Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human adult dermal fibroblasts were lysed in 1 mL Trizol reagent (Invitrogen, 10296028), and RNA was isolated according to the manufacturer’s protocol. cDNA was synthesized by PrimeScript cDNA synthesis kit (Takara, Cat No: 2680A) according to the manufacturer’s protocol. Quantitative PCR (qPCR) was carried out using Power SYBR Mix (Applied Biosystems, Thermo Fisher Scientific, Cat No: A25742) in a Bio-Rad CFX384 machine. GAPDH or TBP expression was used for normalization. Primers used for qPCR are listed below. PTGS2 forward primer) TCCAATGACTCCCAGTCTGAGGA, PTGS2 reverse primer TCAAAGGTCAGCCTGTTTAC, KIT forward primer TGTGTTGTCACCCAAGAGATT, KIT reverse primer CAATGAAGTGCCCCTGAAG, ARHGAP22 forward primer TACAGGGGCTGGTCACTGAG, ARHGAP22 reverse primer GTTCCGCAGCTTTATTTCCA, NEDD9 forward primer GCCTCTAGAAGCAAGTCCGC, NEDD9 reverse primer GGGAGGTGACAGCTAGTCCT.
6
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen tissue was homogenized using an Ultra-Turrax disperser (IKA-Werke, Germany) and RNA extraction was performed with the help of the RNeasy plus Universal Kit (Qiagen, Hilden, Germany) according to the manufacturer´s instructions. 1 μg RNA was reverse transcribed with the iScript™ Reaction Mix kit (Bio-Rad, Munich, Germany) and quantitative RT-PCR (RT-QPCR) was performed using the Power SYBR® Mix (Applied Biosystems, Darmstadt, Germany). Results were normalized to the expression of the house-keeping gene HPRT and evaluated using the ΔΔCt method. Primer sequences are available upon request.
7
Quantitative PCR Telomere Length Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues were mechanically disrupted in the deep frozen state and genomic DNA was isolated using the Qiagen Blood and Tissue Mini Kit (Qiagen, Germany) according to the manufacturer's recommendations, quantified using the NanoPhotometer (Implen, Germany) and stored at -80 °C. Telomere repeat copy number (T) to single-copy gene copy number (S) ratio (T/S ratio) was determined by real-time quantitative PCR using the Power SYBR Mix (Applied Biosystems, Life Technologies USA), as previously described (Callicott & Womack, 2006) . It uses the acidic ribosomal phosphoprotein PO (36B4) gene as the single copy gene, as it is well conserved and has been used for gene dosage studies (Callicott & Womack, 2006) . The PCR reactions were carried out in a MxPro3005P Real Time PCR System (Stratagene, Agilent Technologies, USA) under the following conditions 95 °C-10 min; 40 cycles (95 °C-30 sec; 60 °C-1 min); followed by a dissociation curve. All samples were run in triplicate. Cycle threshold (Ct) values for each sample were calculated using the MxPRo QPCR software (Stratagene, Agilent Technologies, USA). Triplicate Ct values were averaged and the quantity of each sample was calculated using the delta-delta Ct method. Telomere length was given as the T/S ratio. To minimize plate-to-plate variation, comparisons between groups were limited to samples that were run on the same plate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!