Pcdna3 backbone

All constructs were initially cloned into the pcDNA3 backbone (Invitrogen) for ease of comparison. The luciferase constructs (TagRFP-Rluc8.638 (link) was a gift from Dr. Sanjiv Gambhir; Firefly luciferase15 (link) was a gift from Dr. Phil Sharp, Addgene plasmid #11510; Nano-lantern14 (link) was a gift from Dr. Takeharu Nagai, Addgene plasmid # 51970) were all PCR amplified and cloned into the pcDNA3 vector for direct comparison of expression and bioluminescence. The NpHR coding sequence was PCR amplified from the pAAV-eNpHR3.0-EYFP plasmid (gift from Dr. Karl Deisseroth) and inserted into the PCDNA3 vector. The EYFP coding sequence was digested out of this plasmid using EcoRI/NotI restriction sites to leave a backbone containing NpHR. iLMO1 was created by PCR amplifying out the TagRFP-Rluc8.6 cassette and inserting it in-frame downstream of NpHR. iLMO2 was created in a similar fashion, where the Nano-lantern cassette was PCR amplified (Forward primer: 5′ ATCGGAATTCGTGAGCAAGGGCGA, Reverse primer: 5′ ATCGCTCGAGTTACACCTCGTTCTCGTAGCAGAACTGCTCGTTCTTCAGCAC) and cloned downstream of the NpHR coding sequence. Both constructs also included an ER-export sequence39 (link) at the 3′ end of the fusion protein. The iLMO1 and iLMO2 cassettes were subsequently cloned into the FUGW lentiviral backbone and the pAAV backbone for production of 2nd generation lentivirus and AAV2/9, respectively.

ON-TARGETplus SMARTpool small interfering RNAs (siRNAs) were purchased from Dharmacon: ID1 (#L-005051-00-0005), ID3 (#L-009905-00-0005), ROCK1 (#L-003536-00-0005), p120 (#L-012572-00-0005), YAP (#L-012200-00-0005), non-targeting control (#D-001810-10-50). Cells were reverse-transfected with 1 pmol/10 nM of each siRNA in 96-well plates using Lipofectamine RNAiMAX (Life Technologies) and Opti-MEM (Thermo Fisher Scientific) following manufacturer’s instructions. pCDNA3 backbone was from Invitrogen and hE-cadherin-pcDNA3 was a gift from Barry Gumbiner (Addgene plasmid # 45769). Plasmids were forward transfected into cells using FuGENE 6 (Promega). BEZ-235, LY-294002, GSK-1120212, SCH-772984 and LJH-685 were purchased from Selleck Chemicals. Y-27632 was purchased from Sigma Aldrich.