Px330 mcherry

Manufactured by Addgene

Sourced in United States

The PX330-mCherry is a plasmid that contains the Cas9 gene and an mCherry reporter gene. It is used for CRISPR/Cas9-mediated genome editing and can be used to visualize Cas9 expression.

Automatically generated - may contain errors

Lab products found in correlation

Megaclear transcription clean up kit, by Thermo Fisher Scientific (2 mentions) Mmachine t7 ultra transcription kit, by Thermo Fisher Scientific (2 mentions) Megashortscript t7 kit, by Thermo Fisher Scientific (2 mentions) Universal dna purification kit, by Tiangen Biotech (2 mentions) Aria 2, by BD (1 mentions) Facsaria sorp, by BD (1 mentions) Pcmv be3, by Addgene (1 mentions) Be4 gam, by Addgene (1 mentions) Pcmv ha3a be3 y130f, by Addgene (1 mentions) Kod plus neo, by Toyobo (1 mentions) Fugene, by Promega (1 mentions)

5 protocols using px330 mcherry

CRISPR-Mediated Knockout of ALKBH7 in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sense and antisense oligonucleotides for a guide RNA were computationally designed for human ALKBH7 (http://crispr.mit.edu) and cloned into the vector pX330-mcherry (Addgene, 98750). HepG2 cells were transfected using Lipofectamine 2000. After 24 h, HepG2 cells expressing red fluorescent protein were selected by fluorescence-activated cell sorting (Aria II, BD Bioscience) and plated at a very low density. After 5–8 days of cell culture, ALKBH7 knockout was sequenced with the following primers: ALKBH7_Identify-F: GTGCGAGGCTCGGGCCCTTCCGTGC; ALKBH7_Identify-R: CCCCGCCCCAGCGTGGCCCCGCCC. One strain with successful ALKBH7 knockout was used in the current study. The sequences of wild-type ALKBH7 and its knockout are AGCTGCGCCGCCGCCG----(38 base pairs)---- GCCGGGGGCGAGGGAC and AGCTGCGCCGCCGCCGGCCGGGGGCGAGGGAC, respectively.

Zhang L.S., Xiong Q.P., Perez S.P., Liu C., Wei J., Le C., Zhang L., Harada B.T., Dai Q., Feng X., Hao Z., Wang Y., Dong X., Hu L., Wang E.D., Pan T., Klungland A., Liu R.J, & He C. (2021). ALKBH7-mediated demethylation regulates mitochondrial polycistronic RNA processing. Nature cell biology, 23(7), 684-691.

+ Open protocol

+ Expand

CRISPR-Cas9 Mediated DNMT2 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human DNMT2 gene was knocked out using the CRISPR-Cas9 mediated gene targeting technology. Briefly, we designed two single guide RNAs (sgRNAs) targeting exon 1 of DNMT2 (http://crispr.mit.edu/). Sense and antisense oligonucleotides for the sgRNAs were cloned into vector pX330-mCherry (plasmid #98750; Addgene, Watertown, MA, USA) (51 (link)). HEK293T cells (1.0 × 10⁶ cells per well) were transfected with the pX330-mCherry-sgRNA plasmids (1 μg) using lipofectamine 2000 according to the manufacturer's instructions. Twelve hours after transfection, the 293T cells expressing the red fluorescent protein were sorted using flow cytometry (FACS Aria SORP, Becton Dickinson, Franklin Lakes, NJ, USA) and seeded into 96-well plates. Two weeks after the transfection, colonies were isolated and genomic DNAs were extracted. DNMT2 KO cell lines were selected by confirming the frameshift mutations in the target region. The genotyping of HEK293T stable cell lines were analyzed by DNA sequencing of PCR products using the following primers:
hDNMT2-identify-F: GGAGAGGCTGGTCTAATTTC
hDNMT2-identify-R: CAGGATGAAGGACCGAGTCT

Huang Z.X., Li J., Xiong Q.P., Li H., Wang E.D, & Liu R.J. (2021). Position 34 of tRNA is a discriminative element for m5C38 modification by human DNMT2. Nucleic Acids Research, 49(22), 13045-13061.

+ Open protocol

+ Expand

Synthesizing mRNA and sgRNA for Gene Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA transcriptional templates of different base editors and Cre were amplified by PCR using KOD-Plus-Neo (TOYOBO) from plasmids pCMV-BE3 (Addgene#73021), BE4-Gam (Addgene#100806), pCMV-hA3A-BE3-Y130F (Addgene#113428), pCMV-hA3A-eBE3-Y130F (Addgene#113423), xCas9(3.7)-BE3 (Addgene#108380), xCas9(3.7)-BE4 (Addgene#108381) and pZ4f-Cre, purified by the Universal DNA Purification Kit (TIANGEN, Cat#DP214) and then transcribed using the mMACHINE T7 ULTRA Transcription Kit (Invitrogen, Cat#AM1345) following the manufacturer’s instruction. The transcriptional templates of sgRNAs were amplified from pX330-mCherry (Addgene#98750) and transcribed in vitro using the MEGAshortscript T7 kit (Invitrogen, Cat#AM1354) following the manufacturer’s instruction. mRNAs and sgRNAs were subsequently purified with the MEGAclear Transcription Clean-Up Kit (Invitrogen, Cat# AM1908), resuspended in hot (95 °C) RNase-free water and then stored at −80 °C.

Li Q., Lu J., Yin X., Chang Y., Wang C., Yan M., Feng L., Cheng Y., Gao Y., Xu B., Zhang Y., Wang Y., Cui G., Xu L., Sun Y., Zeng R., Li Y., Jing N., Xu G.L., Wu L., Tang F, & Li J. (2023). Base editing-mediated one-step inactivation of the Dnmt gene family reveals critical roles of DNA methylation during mouse gastrulation. Nature Communications, 14, 2922.

+ Open protocol

+ Expand

Efficient CRISPR-Cas9 mRNA and sgRNA Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

BE3 mRNA transcriptional templates were amplified by PCR using KOD-Plus-Neo (TOYOBO) from plasmids pCMV-BE3 (Addgene #73021), purified by the Universal DNA Purification Kit (TIANGEN) and then transcribed using the mMACHINE T7 ULTRA transcription Kit (Invitrogen) following the manufacturer's instructions. The transcriptional templates of sgRNAs were amplified from Px330-mCherry (Addgene #98750) and transcribed in vitro using the MEGAshortscript T7 kit (Invitrogen) following the manufacturer's instructions. mRNAs and sgRNAs were subsequently purified with the MEGAclear Transcription Clean-Up Kit (Invitrogen), resuspended in hot (95°C) RNase-free water and then stored at −80°C.

Zhao T., Li Q., Zhou C., Lv X., Liu H., Tu T., Tang N., Cheng Y., Liu X., Liu C., Zhao J., Song Z., Wang H., Li J, & Gu F. (2021). Small-molecule compounds boost genome-editing efficiency of cytosine base editor. Nucleic Acids Research, 49(15), 8974-8986.

+ Open protocol

+ Expand

CRISPR-mediated gene editing in H1 ESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

H1 ESCs were dissociated into single cells with accutase and re-plated onto Matrigel pretreated 6-well plate with 2 μM Thiazovivin. On the next day, 1 μg px330-mcherry (Addgene, #98750, kindly provided by Dr. Jinsong Li) inserted with sgRNA and 2.5 μg donor vector (T vectors with mutations and recombination homologous arms) were transfected into each well with 8 μl FuGene (Promega, #2311) following the manufacturer’s instructions. 24 h after transfection, mcherry-positive H1 cells were purified by FSCS (BD Influx) and plated onto Matrigel pretreated 10-cm plate with 2 μM Thiazovivin. Single colony was picked about 10 days after sorting. The mutations were validated with PCR and sequencing. The following oligonucleotides were used:

Gao L., Zhang Z., Lu J, & Pei G. (2019). Mitochondria Are Dynamically Transferring Between Human Neural Cells and Alexander Disease-Associated GFAP Mutations Impair the Astrocytic Transfer. Frontiers in Cellular Neuroscience, 13, 316.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!