Log In Sign up
The largest database of trusted experimental protocols

Lipofactamine rnaimax

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in China

Lipofectamine™ RNAiMAX is a transfection reagent developed by Thermo Fisher Scientific for the delivery of small interfering RNA (siRNA) and microRNA (miRNA) into a variety of cell types. It is designed to facilitate efficient and reliable gene silencing in cell-based assays.

Automatically generated - may contain errors

Lab products found in correlation

Lipofactamine 2000 reagent, by Thermo Fisher Scientific (2 mentions) Lenti pac hiv expression packaging mix, by GeneCopoeia (2 mentions) Endofectin lenti transfection reagent, by GeneCopoeia (2 mentions) Sic001, by Merck Group (1 mentions) Opti mem medium, by Thermo Fisher Scientific (1 mentions) Thapsigargin, by Merck Group (1 mentions)

Spelling variants of this product

RNAiMAX (2357 citations) Lipofactamine RNAimax transfection reagent (2 citations)

7 protocols using lipofactamine rnaimax

1

Silencing ATF4 in JEG-3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression of ATF4 was suppressed by RNA interference using Lipofactamine RNAiMax (Invitrogen) as described by the manufacturer. In brief, JEG-3 cells (2.5 × 105) were plated in a six-well plate. The day before reaching approximately 30% to 40% confluence, they were transfected with 30 pmol of siRNA molecules targeted against human ATF4 (SAS1_Hs02_00332313; Sigma-Aldrich) or control siRNA molecules (SIC001; Sigma-Aldrich) using 9 μL of Lipofactamine RNAiMax (Invitrogen) in 300 μL of OptiMEM medium (Invitrogen) for 48 hours. The wells were rinsed with serum-free medium and incubated with 1 mL of serum-free medium that contained 100 nmol/L of thapsigargin (Sigma-Aldrich) for 24 hours.
Lee C.L., Veerbeek J.H., Rana T.K., van Rijn B.B., Burton G.J, & Yung H.W. (2019). Role of Endoplasmic Reticulum Stress in Proinflammatory Cytokine–Mediated Inhibition of Trophoblast Invasion in Placenta-Related Complications of Pregnancy. The American Journal of Pathology, 189(2), 467-478.
+ Open protocol
+ Expand
2

Transfection and Lentiviral Overexpression of miR-1908 in Glioblastoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded into 6-well plates, transfected with miR-1908 mimics or miR controls (50 nM, GenePharma) using Lipofactamine™ RNAiMAX (Invitrogen) and transfected with siMIF (100 nM, Invitrogen) or siRNA controls using Lipofactamine 2000 reagent (Invitrogen), and then harvested for assays 48 h later. The lentiviral plasmid pEZX-MR03 (GeneCopoeia) expressing 1908 (Cat, HmiR0274-MR03) or scrambled miRNA (Cat, CmiR0001-MR03) and Lenti-Pac HIV Expression Packaging mix (GeneCopoeia) were cotransfected into glioblastoma cells using EndoFectin Lenti transfection reagent (GeneCopoeia). After transfection for 48 h, lentiviral particles were harvested and then transduced into the glioblastoma cells, and the stably transfected cells were selected using puromycin and validated by real time Western blot.
Xia X., Li Y., Wang W., Tang F., Tan J., Sun L., Li Q., Sun L., Tang B, & He S. (2015). MicroRNA-1908 functions as a glioblastoma oncogene by suppressing PTEN tumor suppressor pathway. Molecular Cancer, 14, 154.
+ Open protocol
+ Expand
3

Genome Editing Efficiency in U2OS Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
U2OS GFP reporter cell lines, U2OS-EJ5-GFP (NHEJ) and U2OS-DR-GFP (HR), were transfected with the indicated siRNAs by Lipofactamine RNAiMAX (Invitrogen). On the following day, I-SceI endonuclease was delivered to the cells, and 72 hrs later, they were assayed for GFP-positive cells by flow cytometry (BD Biosciences)27 (link).
Koo G.B., Ji J.H., Cho H., Morgan M.J, & Kim Y.S. (2017). Nuclear TRADD prevents DNA damage-mediated death by facilitating non-homologous end-joining repair. Scientific Reports, 7, 3332.
+ Open protocol
+ Expand
4

Lentivirus-Mediated miR-221-3p Overexpression in Gastric Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded into six-well plates, transfected with miR-221-3p mimics or miR controls (50 nM; GenePharma, Shanghai, P.R. China) using Lipofactamine™ RNAiMAX (Invitrogen) and transfected with siMIF (100 nM; Invitrogen) or siRNA controls using Lipofactamine 2000 reagent (Invitrogen), and then harvested for assays 48 h later. The lentiviral plasmid pEZX-MR03 (GeneCopoeia, Rockville, MD, USA) expressing miR-221-3p (Cat. HmiR0274-MR03) or scrambled miRNA (Cat. CmiR0001-MR03) and Lenti-Pac HIV Expression Packaging mix (GeneCopoeia) were cotransfected into gastric cancer cells using EndoFectin Lenti transfection reagent (GeneCopoeia). After transfection for 48 h, lentiviral particles were harvested and then transduced into the gastric cancer cells, and the stably transfected cells were selected using puromycin (2 ng/ml) and validated by RT-PCR.
Shi J., Zhang Y., Jin N., Li Y., Wu S, & Xu L. (2017). MicroRNA-221-3p Plays an Oncogenic Role in Gastric Carcinoma by Inhibiting PTEN Expression. Oncology Research, 25(4), 523-536.
+ Open protocol
+ Expand
5

Knockdown of Key Cell Regulators in PDLSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chemically synthesized double-stranded siRNA against E2F1, EZH2, Lamin A, RB, p130, p107 were transfected alone or in combination into PDLSCs using lipofactamine RNAiMAX (Invitrogen). The siRNA sequences were as follows: siE2F1-1: GACGUGUCAGGACCUUCGU, siE2F1-2: CUGCAGAGCAGAUGGUUAU; siEZH2: AAGACTCTGAATGCAGTTGCT; siLamin A: GAAGGAGGAACTGGACTTCCA; siRB: GCGCUCUUGAGGUUGUAAU; sip130: tcagctgtagtcctcataa; sip107: CAAGCTAATAGTCACGTAT. The adenoviruses expressing ADV4-EZH2 and the control vector were produced by GenePharma (Shanghai, China).
Li Q., Sun X., Tang Y., Qu Y., Zhou Y, & Zhang Y. (2020). EZH2 reduction is an essential mechanoresponse for the maintenance of super-enhancer polarization against compressive stress in human periodontal ligament stem cells. Cell Death & Disease, 11(9), 757.
+ Open protocol
+ Expand
6

Designing Nuclease-Resistant Antisense Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antisense oligos (ASO) with customized chemical modifications were synthesized by IDT. Two modifications were chosen to make ASOs as the nuclease resistant steric blocker at potential cryptic splicing sites: 1) use phosphorothioate instead of phosphodiester in the RNA backbone. 2) 2′-O-methyl modification of each nucleotide. Sequence information of ASOs can be found in Table S5. A transfection mix of either 20 nmol, 50 nmol or 100 nmol of ASOs together with 2.5 µL Lipofactamine RNAiMAX (ThermoFisher, 13778075) was used per well in a 12-well plate.
Wan Y., Anastasakis D.G., Rodriguez J., Palangat M., Gudla P., Zaki G., Tandon M., Pegoraro G., Chow C.C., Hafner M, & Larson D.R. (2021). Dynamic imaging of nascent RNA reveals general principles of transcription dynamics and stochastic splice site selection. Cell, 184(11), 2878-2895.e20.
+ Open protocol
+ Expand
7

CASC3 Gene Knockout Using CRISPR-Cas9

Check if the same lab product or an alternative is used in the 5 most similar protocols
The knockouts were performed using the Alt-R CRISPR-Cas9 system (IDT) and reverse transfection of a Cas9:guideRNA ribonucleoprotein complex using Lipofactamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer's protocol. The crRNA sequences to target CASC3 were /AlTR1/rGrCrGrCrGrCrUrUrCrGrCrArArGrArCrArCrCrGrGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AlTR2/ (clone H) and /AlTR1/rGrUrUrCrGrGrCrCrUrCrCrGrCrGrCrUrGrUrGrArGrUrUrUrUrArGrArGrCrUrArUrGrCrU/AlTR2/ (clones F and T). Reverse transfection was performed on 1.5 × 105 cells per crRNA in 12-well dishes. Forty eight hours after transfection the cells were trypsinized, counted and seeded at a density of a single cell per well in 96-well plates. Cell colonies originating from a single clone were then validated by Sanger sequencing of the targeted genomic DNA locus and western blotting.
Gerbracht J.V., Boehm V., Britto-Borges T., Kallabis S., Wiederstein J.L., Ciriello S., Aschemeier D.U., Krüger M., Frese C.K., Altmüller J., Dieterich C, & Gehring N.H. (2020). CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complex. Nucleic Acids Research, 48(15), 8626-8644.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!