Recombinant taq polymerase

PCR was used to detect CTX-M, TEM, CTX-M-1, CTX-M-2, CTX-M-3, CTX-M-4 and NDM-1 genes. The primer sequences and amplicon sizes are summarized in Table-I.
DNA amplification was performed in a thermal cycler. Each 100 µL reaction mixture contained 10X PCR buffer (50 mM KCl, 10mMTris HCl; pH 8.3); 2.5 mM MgCl₂; dNTPs 0.2 mM each; 50 pmol of each primer; 5 U of recombinant Taq polymerase (Fermentas) and 20ng of DNA template. PCR conditions for the blaCTX-M, blaTEM, blaCTX-M-1, blaCTX-M-2, blaCTX-M-3 and blaCTX-M-4 genes comprised an initial denaturation step for 5 minutes at 95°C, followed by 30 cycles at 95°C for 1minute, 45°C for 30 seconds and 72°C for one minute, with a final extension step at 72°C for 10 minutes. For blaNDM-1, the amplification cycle consisted of five minutes at 95°C, followed by 30 cycles at 94°C for 1 minute, 55°C for 1 minute and 72°C for one minute, with extension at 72°C for seven minutes. The PCR products were visualized by electrophoresis on 1.5% (w/v) agarose gel.

PCR was used to confirm E. coli isolates by targeting a housekeeping gene uidA that encodes for ß-glucuronidase with primers uidA-F ATC ACC GTG GTG ACG CAT GTC GC and uidA-R CAC CAC GAT GCC ATG TTC ATC TGC.10 Each 100 µL reaction mixture comprised of 1x PCR buffer (50 mM KCl, 10mM Tris HCl; pH 8.3); 2.5 mM MgCl₂; dNTP’s 0.2 mM each; 50 pmol of each primer; 5 U of recombinant Taq polymerase (Fermentas) and 20ng of DNA template. The thermal cycler conditions were: denaturation for five minutes at 94°C; 30 cycles of amplification at 94°C for one minute, 50°C for one minute and 72°C for one minute; and finally extension at 72°C for seven minutes. The PCR products were visualized by electrophoresis on 2% (w/v) agarose gel.

Total RNA was isolated using PeqGOLD® TriFast™ reagent (Peqlab, Erlangen, Germany) according to the manufacturer’s instructions. It was quantified with a NanoDrop™ 1000 (Nanodrop, Wilmington, USA) spectrophotometer and checked for intact 18S and 28S RNA by agarose gel electrophoresis. Total RNA (2 µg) was subjected to reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Carlsbad, CA, USA), according to the manufacturer’s instructions. The RT-PCRs for MT₁, MT₂, and β-actin were performed using recombinant Taq-polymerase (Fermentas, St. Leon-Rot, Germany), primers, and reaction conditions as published previously (Schepelmann et al. 2011 (link)). Individual PCR reactions were performed with cDNA corresponding to 400 ng (MT₁, 40 cycles), 400 ng (MT₂, nested PCR; 40 cycle’s outer reaction/20 cycle’s inner reaction), and 50 ng (β-actin, 25 cycles) RNA, respectively.
Negative controls (water instead of cDNA, PCR-neg.co) were used in all reactions. To ensure that the observed amplicons resulted only from reversely transcribed mRNA, samples with no reversely transcribed RNA were included in the PCR setup as well (-RT). Moreover, water instead of RNA was used in the RT reactions (RT-neg.co). The PCR products were analyzed by gel electrophoresis using 1.5% agarose gels containing GelRed and visualized by UV light.

Total RNA was obtained from IL-1β stimulated and H. pylori infected cells lysed with 1 mL of TRIzol (Invitrogen, Carlsbad, CA, USA, number 15596018). Complementary DNA synthesis was performed using 2.5 μg of total RNA in a reaction mixture with SuperScript Kit VILO Master Mix (Invitrogen, Carlsbad, CA, USA, number 11755-050). ZEB1 gene was amplified by using the oligonucleotide pairs, sense: GGG AAT GCT AAG AAC TGC TGG and antisense: GGT GTA ACT GCA CAG GGA GC. For Snail1 gene the oligonucleotides were as follows: sense: TCG GAA GCC TAA CTA CAG CGA and antisense: AGA TGA GCA TTG GCA GCG AG; for CDH1 sense: CCC ACC ACG TAC AAG GGT C and antisense: CTG GGG TAT TGG GGG GCA TC; for RPLP0 sense: ATG GGG AAG CTG AAG GTC GG and antisense: GTG GCA GTG ATG GCA TGG ACT; for GAPDH sense: ATG GGG AAG GTG AAG GTC GG and antisense: GTG GCA GTG ATG GCA TGG ACT. The 20 μL PCR mixture contained 200 μM of dNTPs mix, 2.0 mM of MgCl₂, 200 nM of each primer, Taq Polymerase buffer, and 1.0 U of recombinant Taq Polymerase (Invitrogen, Carlsbad, CA, USA, number 11615-010). The reaction was performed with an initial denaturation step at 94°C for 2 min, followed by 30 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min, and a final extension of 72°C for 5 min.

PCR was conducted on HK-2 cells for sXBP1 and 18S. RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems), as per the manufacturer’s directions. cDNA was amplified with recombinant Taq polymerase (Invitrogen; Mississauga, Canada). PCR products were digested with PstI for 1 h at 37 °C, separated on a 2% agarose gel, and visualized using Safe-Red (Applied Biological Materials Inc; Burlington, Canada) and the ChemiDoc XRS + system (BioRad; Mississauga, Canada).

The fragment containing 81bp Rifampicin Resistant Determining Region (RRDR) of the rpoB gene of all strains were sequenced using published primers [13 ] and analysed in BIOEDIT software using ClustalW alignment parameters (BioEdit version 7.2.5). The PCR was carried out in a total volume of 50μl where 1μl of the DNA was added to the reaction containing 1xPCR reaction buffer, 1.5mM MgCl₂, 0.2mM dNTPs (Invitrogen, UK), 20μM each of both rpoB-RRDR forward (5’- CGATCACACCGCAGACGTTGA) and reverse primers (5’-GGCACGCTCACGTGACAGACC) and 5U recombinant Taq polymerase (Invitrogen, UK). The following PCR conditions were carried out using a Veriti thermocycler (Applied Biosystems, UK): 94°C for 2 min followed by 35 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 1 min. Finally, an extension of 72°C for 10 min was performed before cleaning the products using AmpureXP magnetic beads (Beckman Coulter, UK) according to the manufacturer’s protocol and forward and reverse sequencing performed.

Prior to the fMRI session, all participants underwent a 9 ml venous blood sampling. Genomic DNA was isolated from peripheral lymphocytes with a routine salting-out procedure. For the determination of the MAOA genotype, standard polymerase chain reaction (PCR) amplification was performed in a 25-μl volume containing 80 ng of genomic DNA, 1 unit of recombinant Taq polymerase (Invitrogen, Darmstadt/Germany), PCR buffer (10 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl 2, pH 8.3), 200 mM dNTPs, and 20 pmol of each primer. MAOA primers were obtained from Sabol et al. (1998) (link). The PCR was run on an MJ PTC200 Temperature Cycler (Biozym, Hessisch-Oldendorf, Germany), and each of the 35 cycles consisted of a 95°C denaturation step for 45 s, a 62°C annealing step for 30 s, and, finally, a 72°C elongation step for 90 s. PCR products were run on an automated sequencing system (AB3130, Applied Biosystems, Darmstadt, Germany), and the electropherograms were analyzed with gene mapping software. According to the established classification of Sabol et al. (1998) (link), 3.5 and 4 repeats were classified as representing a high MAO-A expression (MAOA-H) and 3 and 5 repeats as representing a low expression (MAOA-L).