Non specific sirna si nc

Bladder cancer cells were transiently transfected with specific siRNA oligonucleotides and tetracycline-inducible double shRNAs vectors using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. We chose the sequence, ‘TTAACCTCTTCCTATCTCA’ for further study [12 (link)]. Non-specific siRNA (si-NC) and si-CCAT2 were purchased from GenePharma, Suzhou, China. Plasmid Midiprep kits (Promega, Madison, USA) were utilized to get the plasmid vectors (CCAT2 shRNA, NC shRNA) before transfection.

Three human Ki67 exon 7 specific siRNAs were synthesized in GenePharma (Shanghai, China). The sequences are 5′-GAAGCUUUCAACUAGAAAUCG-3′ (siE7-1), 5′-GGUCUUAGUUCAGUUGAUAUC-3′ (siE7-2), and 5′-GUUCAGUUGAUAUCAACAACU-3′ (siE7-3). Nonspecific siRNA (siNC) was obtained from GenePharma (Shanghai, China). siNC was used as a control. The sequences of siRNA against splicing factors are shown in Table S2. All siRNAs were transfected into cells using the Lipofectamine 3000 Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. CAL 27 or SCC-9 cells were seeded into 12-well plates and transfected by 10 nM siRNA on Day 0. Cells were passed and transfected again on Day 2. Total protein and RNA were collected on Day 4.

The A549 (ATCC, Manassas, VA, USA; CRM‐CCL‐185), A549 cisplatin‐resistant (A549/DDP; National Infrastructure of Cell Line Resource, Beijing, China; 1101HUM‐PUMC000519), and human lung bronchial epithelial 16HBE cells (Shanghai Fuheng Biotechnology Co., Ltd. China; FH1013) were cultured in RPMI 1640 medium (Hyclone, Logan, UT, USA) with 10% fetal bovine serum and 1% penicillin/streptomycin (Life Technologies) in an atmosphere of 5% carbon dioxide and 95% air at 37°C.
Lung cancer cells were transfected with USP14 siRNA (siUSP14#1 and siUSP14#2) or nonspecific siRNA (siNC) (all from Shanghai GenePharma Co., Ltd, China) using DharmaFECT one siRNA infection reagent (Thermo Fisher Scientific). The siRNA sequences were: siUSP14#1: GACAGAAAGUUAUGGUGAAAG; siUSP14#2: AGUUCUUAAGGAUGUUAAAUU; siNC: GGACGAGCUGUACAAGUAA. For USP14 overexpression, the coding sequence was synthesized and cloned into pLVX‐Puro plasmids (TSPLA16346, Testobio Co., Ltd, Ningbo, China). Recombinant plasmids, along with psPAX2 (#12260) and pMD2.G (#12259) packaging plasmids (all from Addgene Headquarters, Watertown, MA, USA), were co‐transfected into 293T cells (ATCC; CRL‐3216) by using Lipofectamine 2000 (Thermo Fisher Scientific). At 48 h post‐transfection, recombined vectors were used for cell transduction. The empty vector and nonspecific siRNA acted as negative controls.