Sentifast cdna synthesis kit

Manufactured by Meridian Bioscience

Sourced in Germany

The SentiFAST cDNA synthesis kit is a laboratory tool used for the reverse transcription of RNA into complementary DNA (cDNA). It provides the essential components and protocols for efficient and reliable cDNA synthesis from RNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions) Rneasy fibrous tissue mini kit, by Qiagen (1 mentions) Cfx manager software, by Bio-Rad (1 mentions) Kapa sybr fast qpcr kit, by Roche (1 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Molecular Research Center (1 mentions)

Close spelling variants of this product

CDNA synthesis kit

2 protocols using sentifast cdna synthesis kit

Quantifying VCAM-1 Expression in AMI

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cryopreserved infarct and remote tissue was homogenized (n = 5 or 6 per group) and RNA was isolated using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. Quantity and Quality (A260/A280 ratio) of isolated RNA was determined with a NanoDrop ND10000 spectrophotometer (Thermo Fischer Scientific, USA) and RNA integrity was confirmed by using the Agilent Bioanalyzer 2100. Next, cDNA was synthesized from 500ng of RNA using the SentiFAST cDNA synthesis kit (Bioline, Luckenwalde, Germany).
Using the comparative Ct (ΔCt) method (forward primer: TGTGAAGGGATTAACCAGGCT, reverse primer: CAGTGTCCCCTTCCTTGACG) VCAM-1 expression was determined. Results are expressed as fold-increase to the normalized day 1 post-AMI remote expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH, forward primer: GCTCATTTCCTCGTACGACAAT, reverse primer: GAGGGCCTCTCTCCTCCTCGC) using the CFX manager software (Bio-Rad). PCR product accurateness was confirmed by sequencing.

Uitterdijk A., Groenendijk B.C., Gorsse-Bakker C., Panasewicz A., Sneep S., Tempel D., van de Kamp E.H., Merkus D., van der Giessen W.J, & Duncker D.J. (2017). Time course of VCAM-1 expression in reperfused myocardial infarction in swine and its relation to retention of intracoronary administered bone marrow-derived mononuclear cells. PLoS ONE, 12(6), e0178779.

+ Open protocol

+ Expand

Quantifying Target Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from pMMCs or kidney tissues was isolated using TRI Reagent (Molecular Research Center) following the manufacturer’s protocol. cDNA was synthesized using RT-PCR with a SentiFAST cDNA Synthesis kit (Bioline) according to the manufacturer’s protocol. Quantitative real-time PCR was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems). KAPA SYBR fast qPCR kit (KAPA Biosystems) for primers shown in Table S5. The relative expression level of each target genes were normalized by 18S as a house-keeping gene.

Lee S.R., Lee H.E., Yoo J.Y., An E.J., Song S.J., Han K.H., Cha D.R, & Bae Y.S. (2024). Nox4-SH3YL1 complex is involved in diabetic nephropathy. iScience, 27(2), 108868.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!