The largest database of trusted experimental protocols

Anti yy1 antibody

Manufactured by Santa Cruz Biotechnology
Sourced in United States

The Anti-YY1 antibody is a laboratory reagent used in research applications. It is designed to detect and bind to the YY1 protein, which is a transcription factor involved in the regulation of gene expression. This antibody can be used in various experimental techniques, such as Western blotting, immunoprecipitation, and immunohistochemistry, to study the expression and localization of the YY1 protein in biological samples.

Automatically generated - may contain errors

5 protocols using anti yy1 antibody

1

ChIP-qPCR analysis of YY1 binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation (ChIP) was performed using an anti-YY1 antibody (Santa-Cruz; cat#sc-1703) as previously described [30 (link)]. In brief, chromatin collected from BMSCs was cross-linked using 1.0% formaldehyde and fragmented to about 200–1000 bp through sonication. Then 20 μg of chromatin was precleared with protein G-agarose beads (Santa Cruz) for 2 h at 4 °C, followed by immunoprecipitation with 3 μg of anti-YY1 antibody overnight at 4 °C. Precipitated samples were eluted and reverse cross-linked, and the ChIP DNA was analyzed using q-PCR. Four PCR primers were used: 5′- AGGTAGCGTTTGCTTTCTCACCCA -3′ (forward) and 5′-CAGCAATGCCAAGGGTAAACGGAA -3′ (reverse) (XIST promoter region); 5′- AGGGCTGCTCAGAAGTCTATCTCGGGGGCTC -3′ (forward) and 5′-GAGCCCCCGAGATAGACTTCTGAGCAGCCCT -3′ (reverse) (XIST promoter site1 region);
5′- CATTTAGGTCGTACAGGAACTCAAGTTCTTGGTGCGG -3′ (forward) and 5′- CGCACCAAGAACTTGAGTTCCTGTACGACCTAAATG -3′ (reverse) (XIST promoter site2 region); 5′- A ATGCTCTTGAATGTGTCTAAGTCATGTGACCTGCCC -3′ (forward) and 5′- GGGCAGGTCACATGACTTAGACACATTCAAGAGCAT -3′ (reverse) (XIST promoter site3 region).
+ Open protocol
+ Expand
2

Chromatin Immunoprecipitation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatins were prepared from MEF according to the method previously described5 (link). In brief, the homogenized samples were first cross-linked with 1% formaldehyde for 20 mins, and then lysed with the buffer containing protease inhibitor cocktail (Millipore, Cat. No. 539131). The released nuclei were fractionated with sonication to derive a pool of DNA fragments size-ranging from 300 to 500 bp in length. The prepared chromatin was immunoprecipitated with two commercial antibodies: anti-YY1 antibody (SantaCruz Biotech, Cat. No. sc-1703) and anti-H3K27ac antibody (Abcam, Cat. No. ab4729). The immunoprecipitated DNA was dissolved in 80 μl of TE for PCR analyses.
+ Open protocol
+ Expand
3

Western Blot Analysis of YY1 and FEN1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting analysis was performed according to standard procedures using ECL detection substrate (Pierce, Rockford, IL, USA) and the blot was exposed to the Tannon 5200 System for visualization. The antibodies used in our studies were the rabbit polyclonal anti-YY1 antibody (Santa Cruz), the rabbit monoclonal anti-FEN1 antibody (Novus Biologicals, Littleton, CO, USA), the Horseradish peroxidase (HRP)-conjugated anti-GAPDH (GenScript, China), and the Horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody (Pierce, Rockford, IL, USA).
+ Open protocol
+ Expand
4

ChIP Assay for BRCA1 Promoter Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed as previously described.[23, 46] Cells were cross‐linked with 1% v/v formalin. DNA was extracted from YY1 immunoprecipitates. For the PCR, a 2 µL aliquot of DNA extract (30 µL) and VENT polymerases (Biolabs, Northbrook, IL) were used. Anti‐YY1 antibody was purchased from Santa Cruz Biotechnology (Dallas, TX). The ChIP primers for the BRCA1 promoter are listed in Table S1 (Supporting Information).
+ Open protocol
+ Expand
5

Cellular Signaling Modulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sebacic acid, valproic acid, and O-tetradecanoylphorbol-13-acetate (TPA) were purchased from FUJIFILM Wako Pure Chemicals (Osaka, Japan). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and anti-mouse IgG peroxidase antibody were purchased from Sigma-Aldrich (St. Louis, MO). Brefeldin A was purchased from Tokyo Chemical Industry (Tokyo, Japan). Anti-phospho-JNK, anti-JNK, anti-phospho-p38, anti-p38, anti-NF-κB, anti-phospho-STAT1, anti-STAT1, anti-phospho-STAT3, and anti-STAT3 antibodies were purchased from Cell Signaling Technology (Danvers, MA). Anti-YY-1 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase (HRP)-conjugated anti-rabbit IgG antibody and HRP-conjugated anti-mouse IgG antibody were purchased from Sigma-Aldrich. HDAC1 Inhibitor Screening Assay Kit was purchased from Cayman Chemical (Ann Arbor, MI).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!