Log In Sign up
The largest database of trusted experimental protocols

Pbi cmv1

Manufactured by Takara Bio
Visit Supplier

The PBI-CMV1 is a lab equipment product from Takara Bio. It is a plasmid-based expression vector designed for efficient expression of target genes in mammalian cells. The core function of the PBI-CMV1 is to facilitate protein production in cell culture systems.

Automatically generated - may contain errors

Lab products found in correlation

Pcdna3, by Thermo Fisher Scientific (3 mentions) Pfu mviia pc, by Addgene (2 mentions) Bacmam kv1, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Firefly luciferase, by Promega (1 mentions) Pcdna5 frt to vector, by Thermo Fisher Scientific (1 mentions) Nanoluciferase, by Promega (1 mentions) Quikchange lightning multi site directed mutagenesis kit, by Agilent Technologies (1 mentions) Mceruleann1, by Addgene (1 mentions) Pcdna5 frt plasmid, by Thermo Fisher Scientific (1 mentions)

8 protocols using pbi cmv1

1

Engineered Optogenetic Fusion Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genes encoding for fusion proteins were assembled as a multicomponent cloning cassette from annealed oligonucleotides (IDT DNA) containing these elements (in order): BglII or NheI or BamHI — Secretion Signal/FLAG tag — HindIII — (αDTX or DTX-K or CONK1) — KpnI — Linker — LOV2-Jα(404–546) — NotI — PDGF-R-mCherry — XbaI or EcoRI. PDGF-R-mcherry was derived from pFU-MVIIA-PC (Addgene)10 (link). See Table 1 for sequence details. This cassette was inserted into the mammalian expression vector pcDNA3.1(+) (Invitrogen) using NheI / Xba restriction sites or a lentiviral vector containing the CAMKII promoter35 (link),36 (link) using BamHI / EcoRI sites. The respective genes coding for rat Kv1.2 (Kv1.2), rat Kv1.1 (Kv1.1) or Shaker were amplified from Kv1.2-pBluescript, Shaker-pBluescript (gifts from Roderick Mackinnon), or BacMam Kv1.1 (Invitrogen) and inserted into pcDNA3.1(+) or pEGFP-N3 using BamHI / EcoRI or NheI/EcoRI, respectively. Both αDTX-lumitoxin and Kv1.2 cassettes were also inserted into the bidirectional expression vector pBI-CMV1 (Clontech) using BglII / XbaI and BamHI / NotI sites respectively, to drive expression from the same plasmid.
Schmidt D., Tillberg P.W., Chen F, & Boyden E.S. (2014). A fully genetically-encoded protein architecture for optical control of peptide ligand concentration. Nature communications, 5, 3019.
+ Open protocol
+ Expand
2

Overexpression of KIF11 in CL1-0 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
KIF11 human cDNA (Origene, SC110939) was cloned into pBI-CMV1 (Clontech), together with mCherry to facilitate scoring of transfected cells. CL1-0 cells were transfected using Lipofectamine 3000 (Invitrogen), harvested after 48 hr, and examined by immunofluorescence microscopy.
Yang C.F., Tsai W.Y., Chen W.A., Liang K.W., Pan C.J., Lai P.L., Yang P.C, & Huang H.C. (2016). Kinesin-5 Contributes to Spindle-length Scaling in the Evolution of Cancer toward Metastasis. Scientific Reports, 6, 35767.
+ Open protocol
+ Expand
3

Engineered Optogenetic Fusion Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genes encoding for fusion proteins were assembled as a multicomponent cloning cassette from annealed oligonucleotides (IDT DNA) containing these elements (in order): BglII or NheI or BamHI — Secretion Signal/FLAG tag — HindIII — (αDTX or DTX-K or CONK1) — KpnI — Linker — LOV2-Jα(404–546) — NotI — PDGF-R-mCherry — XbaI or EcoRI. PDGF-R-mcherry was derived from pFU-MVIIA-PC (Addgene)10 (link). See Table 1 for sequence details. This cassette was inserted into the mammalian expression vector pcDNA3.1(+) (Invitrogen) using NheI / Xba restriction sites or a lentiviral vector containing the CAMKII promoter35 (link),36 (link) using BamHI / EcoRI sites. The respective genes coding for rat Kv1.2 (Kv1.2), rat Kv1.1 (Kv1.1) or Shaker were amplified from Kv1.2-pBluescript, Shaker-pBluescript (gifts from Roderick Mackinnon), or BacMam Kv1.1 (Invitrogen) and inserted into pcDNA3.1(+) or pEGFP-N3 using BamHI / EcoRI or NheI/EcoRI, respectively. Both αDTX-lumitoxin and Kv1.2 cassettes were also inserted into the bidirectional expression vector pBI-CMV1 (Clontech) using BglII / XbaI and BamHI / NotI sites respectively, to drive expression from the same plasmid.
Schmidt D., Tillberg P.W., Chen F, & Boyden E.S. (2014). A fully genetically-encoded protein architecture for optical control of peptide ligand concentration. Nature communications, 5, 3019.
+ Open protocol
+ Expand
4

Heteromeric GPCR Complex Formation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human GIRK1 and GIRK4 subunits of the atrial K+ channel were sub-cloned within the multiple cloning sites MCS1 and MCS2, respectively, of the bidirectional expression vector pBI-CMV1 (Clontech Laboratories, Inc., Catalog # 631630). N-terminally c-Myc-tagged wild-type human 5-HT2A (Myc-2AR) and N-terminally HA-tagged human mGlu2R (HA-mGlu2R) have been previously described [13 (link)]. For antibiotic selection purposes, the above constructs were sub-cloned in the pcDNA3.1/hygro and pcDNA3.1/neo vectors, respectively. All constructs were confirmed by DNA sequencing. Constructs used in transient transfection controls for the binding assays: The N-terminally c-Myc-tagged form of the wild-type human 5-HT2A and the N-terminally hemagglutinin (HA)-tagged form of wild-type mGlu2, as well as substitution of residues Ala-6774.40, Ala-6814.44 and Ala6854.48 in mGlu2R for Ser6864.40, Phe6904.44 and Gly-6944.48 in mGlu3R (HA-mGlu2ΔTM4N) have been described previously [29 (link)]. Superscripts in this form indicate Ballesteros-Weinstein numbering for conserved GPCR residues [29 (link)]. It has also been shown that the mGlu2/mGlu3 chimeric construct does not form a heteromeric complex with 2AR [29 (link)].
Baki L., Fribourg M., Younkin J., Eltit J.M., Moreno J.L., Park G., Vysotskaya Z., Narahari A., Sealfon S.C., Gonzalez-Maeso J, & Logothetis D.E. (2016). Cross-signaling in metabotropic glutamate 2 and serotonin 2A receptor heteromers in mammalian cells. Pflugers Archiv : European journal of physiology, 468(5), 775-793.
+ Open protocol
+ Expand
5

Dual Luciferase Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
All plasmids in this study were generated using the pcDNA5/FRT/TO vector (Thermo Fisher Scientific). The dual expression cassette containing a shared enhancer and minCMV promoters was subcloned from the pBI-CMV1 (Clontech) into the pcDNA5 vector using restriction enzyme digest and Gibson assembly. Nano luciferase (Promega) and Firefly luciferase (a gift from David Bedwell) were inserted into this construct also using Gibson assembly to generate a template expressing full-length versions of both luciferase constructs. PTCs were then inserted via site-directed mutagenesis using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) to generate the constructs tested here.
Wangen J.R, & Green R. (2020). Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides. eLife, 9, e52611.
+ Open protocol
+ Expand
6

Fluorescent Reporter Plasmid Construction

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The set of fluorescent reporters coding for eYFP and mCherry was obtained from Addgene (#31463, #31464, #31465, and #31466, deposited by Phil Sharp Lab) and are the same as those used in [17 (link)]. The second set of fluorescent reporters were cloned into pBI-CMV1 (Clontech). A nuclear localization sequence (NLS) (ATGGGCCCTAAAAAGAAGCGTAAAGTC) was appended to mCerulean-N1 (Addgene #27795, deposited by Steven Vogel Lab [57 (link)]) by PCR and then inserted into the main vector with ClaI and BamHI. mKOrange-NLS (Addgene #37346, deposited by Connie Cepko Lab [58 (link)]) was cloned into the vector using EcoRI blunt and BamHI. miR-20a regulatory elements were appended to the 3′ UTR of mCerulean with the same strategy applied in [17 (link)]: the N=1 bulged miR-20 binding site (TACCTGCACTCGCGCACTTTA) was appended by PCR and for both constructs, CCGG spacers separate subsequent miR-20a regulatory elements.
Bosia C., Sgrò F., Conti L., Baldassi C., Brusa D., Cavallo F., Cunto F.D., Turco E., Pagnani A, & Zecchina R. (2017). RNAs competing for microRNAs mutually influence their fluctuations in a highly non-linear microRNA-dependent manner in single cells. Genome Biology, 18, 37.
+ Open protocol
+ Expand
7

Generation of pDF_FRT Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
For generation of the integration plasmid pDF_FRT, eGFP and mCherry expressed from a shared CMV enhancer/promoter element (pBI-CMV1; Clontech), were inserted into the NotI and NheI sites of the pcDNA5/FRT plasmid (Invitrogen). pDF_FRT_UCP3_wt and _MUTI/II were generated by hybridization of complementary oligonucleotides and insertion downstream of eGFP into the NotI and HindIII restriction sites of pDF_FRT.
The complete vector sequences are available upon request.
Braun J., Fischer S., Xu Z.Z., Sun H., Ghoneim D.H., Gimbel A.T., Plessmann U., Urlaub H., Mathews D.H, & Weigand J.E. (2018). Identification of new high affinity targets for Roquin based on structural conservation. Nucleic Acids Research, 46(22), 12109-12125.
+ Open protocol
+ Expand
8

Synthetic TCR Expression Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti-V24PE antibodies were from Beckman Coulter. eBioscience Human IL-2 ELISA Ready-Set-Go Kit was bought from Fisher Scientific.
1.4 pMJA219 TRBV25/TRAV10 expression plasmid A synthetic expression DNA plasmid (pMJA219, GenBank MH782476) containing TCR receptors has been synthesised (Geneart) based on the backbone of the mammalian expression plasmid pcDNA3.1(+)(Invitrogen). The / TCR sequences used in pMJA219 design have been previously described as -GalCer specific using lipid loaded tetramers (Brigl et al., 2006) (link). pMJA219 is driven by the bidirectional Cytomegalovirus promoter from pBI-CMV1 (Clontech) and flanked by the rabbit -globin and bGH (bovine Growth Hormone) polyadenylation sequences at the 3' end of TRBV25 and TRAV10 sequences respectively. The complete TCR expression plasmid contains the human -GalCer responsive TRAV10 (clone J3N.5T, GenBank DQ341448.1) and TRBV25 (clone BM2a.t, GenBank DQ341454.1) cDNA complete sequences without introns (Brigl et al., 2006) (link). pMJA219 carries selectable markers for Ampicillin for E. coli and G418 (Geneticin) for mammalian cells.
Wang R., Pscheid R., Ghumra A., Kan L.Y.L., Cochrane S., Fairclough L, & Alcocer M.J.C. (2019). Towards a surrogate system to express human lipid binding TCRs. Biotechnology letters, 41(10).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!