Real-time PCR analyses were conducted using primers listed in Table 1 and FastStart SYBRGreen kit (Roche, Switzerland) on LightCycler 480 machine (Roche, Switzerland). The reaction mix included 3 pmol of forward and reverse primers, 2 ng of template DNA, 5 μl of 2 x concentrated kit, and water up to 10 μl. Standards were prepared from pure amplicons generated with primer pairs used for qPCR on DNA isolated from Escherichia coli, P. sylvestris, and Boletus badius. Standard curves were replicated five times, and samples were assayed in triplicates. Each run included negative control (water). Resulting numbers of copies were converted to copies/g of litter.
Fast start sybr green kit
Manufactured by Roche
Sourced in Germany
The Fast start SYBR Green Kit is a reagent kit used for real-time PCR (polymerase chain reaction) experiments. The kit contains all the necessary components, including SYBR Green I dye, to perform efficient and sensitive DNA amplification and detection.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Rotor gene 3000 real time thermal cycler, by Qiagen (3 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
Dnase, by Thermo Fisher Scientific (3 mentions)
Rnaqueous 96 isolation kit, by Thermo Fisher Scientific (2 mentions)
Abi 7500 fast, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
Lightcycler 480, by Roche (1 mentions)
Mir xtm mirna first strand synthesis kit, by Takara Bio (1 mentions)
Cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions)
Abi 7500 fast cycler, by Thermo Fisher Scientific (1 mentions)
Taq man gene expression assays, by Thermo Fisher Scientific (1 mentions)
9 protocols using fast start sybr green kit
1
Real-time PCR Quantification of Microbial DNA
2
Quantitative Transcript Analysis of SeV N
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were extracted using the RNAqueous-96 Isolation Kit (Ambion) and quantified. Reverse transcription was performed using 1 μg total RNA using the Quantitect reverse Transcription kit (Qiagen). Specific mRNA levels were quantified by qPCR using Fast start SYBR Green Kit (Roche) for SeV N (S: agtatgggaggaccacagaatgg, AS: ccttcaccaacacaatccagacc). A reaction without RT and a reaction with H2O were performed with each run to ensure absence of genomic DNA contamination. Fluorescence was collected using the Rotor-Gene 3000 Real Time Thermal Cycler (Corbett Research). Results were analyzed by the ΔΔCT method after normalization to S9 mRNA levels (S: cgtctcgaccaagagctga, AS: ggtccttctcatcaagcgtc).
3
Quantifying mRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA containing the miRs was isolated from cells and frozen aorta tissues using TRIzol, according to the manufacturer's instructions (Invitrogen). For each sample, the total RNA content was determined by measuring the absorbance at 260 nm and the purity was determined using A260/A280 ratios. For qRT-PCR, the first strand cDNA of miRNA and mRNA was reverse transcribed from total RNA using the Mir-XTM miRNA first strand synthesis kit and PrimeScript™ RT reagent kit with gDNA eraser (Takara Biotechnology, Dalian, China), respectively, and 2 μL of the first strand cDNA was used for detecting mRNA and miRNA expression using the real-time polymerase chain reaction (RT-PCR) (ABI 7500 Fast; Applied Biosystems, Darmstadt, Germany) using the FastStart SYBR Green Kit (Roche, East Sussex, UK). The specific PCR primers used were rat MMP2 (forward primer, 5′-ACCTTGACCAGAACACCATCGAG-3′, reverse primer, 5′-CAGGGTCCAGGTCAGGTGTGTA-3′) and rat β-actin (forward primer, 5′-GGAGATTACTGCCCTGGCTCCTA-3′, reverse primer, 5′-GACTCATCGTACTCCTGCTTGCTG-3′). The rat U6 primer and miR-29b-3p were purchased from Genecopoeia (Guangzhou, China). Expression of MP2 and miR-29b-3p were normalized with β-actin and U6, respectively, and the relative expression was determined by the comparative CT (2−ΔΔCt) method.
4
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol (Invitrogen), and treated with DNase (Thermo Scientific). Reverse-transcription was performed with a cDNA Reverse Transcription Kit (Applied Biosystems). For real-time PCR, target RNA was amplified with gene-specific primers (see below) using the FastStart SYBR Green kit (Roche) on a 7900HT Fast Real-Time PCR System (Applied Biosystems). PCR reaction was initiated by heat activation of the FastStart Taq DNA polymerase at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec, 58°C for 30 sec, and 72°C for 60 sec. Relative levels were calculated using the comparative CT method. Data were normalized to 18S or actin [44 (link)].
5
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from Beas-2B cells was extracted according to the manufacturer's instructions (Qiagen, CA). Total RNA was reverse transcribed using the PrimeScript RT Reagent Kit (Takara, Japan). qRT-PCR was performed with Faststart SYBR Green Kit (Roche, Germany). The relative levels of mRNA were normalized to the expression of actin and analyzed using in relative units.
6
Quantifying NOX/DUOX Isoforms in Breast Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from MCF-7 and ZR75.1 cells was prepared using the RNAqueous-96 Isolation Kit (Ambion). Total RNA from primary breast tumors was prepared as described in [37 (link)]. Total RNA was subjected to reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative PCR amplifications of IKKε, NOX2, NOX5, S9 and β-actin genes were performed using the Fast start SYBR Green Kit (Roche) in a Rotor-Gene 3000 Real-Time Thermal Cycler (Corbett Research). Absence of genomic DNA contamination was analyzed using a reaction without reverse transcriptase. Gene expression normalized over actin or S9 was analyzed using the ΔΔ Cycle threshold (Ct) method [38] (link) or as absolute mRNA copy numbers using plasmid-based standard curves as described in [39] (link). RT-PCR analysis of NOX/DUOX isoforms expression was performed as previously described [35] (link). Positive controls were used for each gene, as follows: total RNA from colon was used for NOX1; total RNA from DMSO-differentiated HL60 was used for NOX2; total RNA from human fetal kidney was used for NOX3; total RNA from MRC-5 were used for NOX4; total RNA from human spleen was used for NOX5; total RNA from human thyroid was used for DUOX1 and DUOX2. Human thyroid total RNA, human fetal kidney total RNA, human colon total RNA, and human spleen total RNA were purchased from BD Clontech.
7
Quantitation of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from serum samples using TRIzol according to the manufacturer’s instructions (Invitrogen, Carlsbad, California, USA). For each sample, the total RNA content was determined by measuring the absorbance at 260 nm and the purity was ascertained in terms of A260/A280. First strand cDNAs of the miRNAs and mRNAs were synthesized using the Mir-X miRNA first strand synthesis kit and PrimeScript RT reagent kit with gDNA eraser (Takara Biotechnology, Dalian, China) respectively. RT-PCR was performed using 2 µl of each cDNA template and the FastStart SYBR Green Kit (Roche, East Sussex, UK) on the ABI 7500 Fast cycler (Applied Biosystems, Darmstadt, Germany)41 (link). The primer sequences are shown in Supplementary Information-Table S2 .
8
RNA Extraction and qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from the cultured VSMCs according to the manufacturer's protocol. The integrity of the isolated RNA was determined by measuring the absorbance at 260 nm (A260) and the purity in terms of the A260/A280 ratio. Total RNA was reverse-transcribed into complementary (c)DNA using the TransScript kit (Takara Biotechnology, Inc.). qPCR was performed with 2 µl first-strand cDNA as the template and the FastStart SYBR Green kit (Roche). The primers were purchased from GeneCopoeia Biotechnology Company and their sequences are presented in Table I . The thermocycling conditions of qPCR were as follows: 2 min at 50˚C and 10 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C, 30 sec 60˚C and 30 sec at 72˚C (ABI 7500 Fast; Applied Biosystems; Thermo Fisher Scientific, Inc.). GAPDH and U6 were used as the internal controls for mRNAs and miRNAs, respectively. The relative expression of these genes was determined using the comparative CT (2-ΔΔCq) method (28 (link)).
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using the RNAqueous-96 Isolation Kit (Invitrogen-Thermo Fisher, Carlsbad, CA, USA) following the manufacturer’s instructions. Total RNA (1 µg) was subjected to reverse transcription using the QuantiTect Reverse Transcription Kit (Qiagen, Toronto, ON, Canada). Quantitative PCR were performed using either Fast start SYBR Green Kit (Roche, Indianapolis, IN, USA) for MX1, IDO, APOBEC3G, CXCL10, NOD2, PKR, IRF1, IFIT1 and IL8 or TaqMan Gene Expression Assays (Life Technologies-Thermo Fisher) for DUOX2, IFI27, SERPINB2, IL33, CCL20, ISG20. Sequences of oligonucleotides and probes used in PCR reactions are described in Supplemental Table S4 . Data collection was performed on a Rotor-Gene 3000 Real Time Thermal Cycler (Corbett Research, Mortlake, Australia). Gene inductions were normalized over S9 levels, measured using Fast start SYBR Green Kit or TaqMan probe as necessary. Fold induction of genes was determined using the ΔΔCt method [19 (link)]. All qRT-PCR data are presented as the mean ± standard error of the mean (SEM).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!