The fragment containing the breakpoint junction was amplified using Q5 High-Fidelity DNA Polymerase (M0491S, NewEngland Biolabs, Evry-Courcouronnes, France) with the following primers. 5′-AATTGCAGGTCCAAGGTTTTC-3′ for the intron 48 primer, and 5′GTTTGCCATTTGACTTGCCAG for the intron 49 primer. To sequence the fragment of interest, DNA was purified and then reacted with Big Dye buffer (Taq polymerase, dNTP and fluorescent ddNTP)(4336697, Thermo Fisher, Villebon-Sur-Yvette, France) and specific primers (see above), followed by sequencing on the ABI PRISM 3130 Genetic Analyzer.
Big dye buffer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Big Dye buffer is a reagent used in DNA sequencing applications. It is designed to facilitate the DNA sequencing process by providing the necessary components for the sequencing reaction. The buffer contains essential elements required for the enzymatic incorporation of fluorescently labeled nucleotides during the sequencing process. This product is intended to be used as part of a DNA sequencing workflow, but a detailed description of its intended use or performance characteristics is not available.
Automatically generated - may contain errors
Lab products found in correlation
3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Hi di formamide, by Thermo Fisher Scientific (2 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Ethanol, by Honeywell (1 mentions)
Qiaquick pcr purification system, by Qiagen (1 mentions)
96 well optical plate, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator mix, by Thermo Fisher Scientific (1 mentions)
Sephadex g50 resin, by Merck Group (1 mentions)
3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Dna clean and concentrator kit, by Zymo Research (1 mentions)
Abi 3730 automatic dna sequencer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator, by Thermo Fisher Scientific (1 mentions)
6 protocols using big dye buffer
1
Amplification and Sequencing of Breakpoint Junction
2
Ethanol-based Purification of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR product was purified in 96-well plates using ethanol (Riedel de Haen; Munich, Germany). Approximately 60 µL of (100%) absolute ethanol was added to each well that contained the product of a sequencing reaction and was incubated at room temperature. After the mixture centrifugation at 1008 RCF for 30 min, 70 μL of 70% ethanol was added and centrifuged again. Then, 10 µL of formamide was added to each well and the plate was spun. The plate was incubated in PCR at 95 °C for 5 min. The reaction was done by using a Big Dye buffer (Thermo Fisher Scientific, Vienna, Austria). Mixture one was prepared, which contained 1.5 µL of Exosap and 3 µL of purified PCR product. The mixture was incubated at 37 °C for 15 min. The reaction was stopped by heating the mixture at 85 °C for 15 °C.
3
PCR Amplicon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For sequencing, PCR amplicons were purified using QIAquick PCR purification system (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations (QIAGEN GmbH 2006). In a 96-well plate, 10 μL reactions were then set up, containing 2 μL of the purified amplicon, a sequencing primer at 2 μM, 1x Big Dye buffer (Applied Biosystems), 1 μL of Big Dye Ready Reaction Mix v3.1 (Applied Biosystems), and nuclease-free water. The plate was sealed and pulse centrifuged, after which the PCR was performed under the following conditions: and initial 94 °C for 4 sec, followed by 25 3-step cycles at 94 °C for 30 sec, 50 °C for 15 sec, and 60 °C for 4 min. Sequence reaction products were purified with the Agencourt CleanSEQ sequencing reaction clean-up system (Protocol 000600v031, 2006, Agencourt Bioscience, USA). Purified DNA was resuspended in 40ul of nuclease-free water (Life technologies, Ambion, USA). The products were transferred into a 96-well optical plate (Applied Biosystems, USA) and read using a 3130xl Genetic Analyzer (Applied Biosystems, USA) to generate sequence data.
4
Sanger Sequencing of Bacterial Amplicons
Check if the same lab product or an alternative is used in the 5 most similar protocols
spa and MLST amplicons were purified using the DNA Clean and Concentrator kit (Zymo Research, Irvine, California, USA) following the manufacturer’s instructions with a final elution volume of 30 µl. Both forward and reverse strands were sequenced. Each reaction contained 4 µl of sterile distilled water, 2 µl of 5X Big Dye buffer (Applied Biosystems, Foster City, California, USA), 1 µl (4 µM) of the PCR primer, 1 µl of Big Dye terminator mix (Applied Biosystems, Foster City, California, USA) and 4 µl of amplicon DNA. Cycle sequencing was performed on an ABI 9700 thermocycler with cycling conditions set as: 94 °C for 5 min followed by 30 cycles of 94 °C for 15 s, 55 °C for 30 s and 68 °C for 2.5 min with a final extension of 68 °C for 3 min. Sequencing fragments were purified using Sephadex G50 resin (Sigma-Aldrich, St Louis, Missouri, USA) before loading on the Applied Biosystems 3500 Genetic Analyzer.
+ Expand
spa and MLST amplicons were purified using the DNA Clean and Concentrator kit (Zymo Research, Irvine, California, USA) following the manufacturer’s instructions with a final elution volume of 30 µl. Both forward and reverse strands were sequenced. Each reaction contained 4 µl of sterile distilled water, 2 µl of 5X Big Dye buffer (Applied Biosystems, Foster City, California, USA), 1 µl (4 µM) of the PCR primer, 1 µl of Big Dye terminator mix (Applied Biosystems, Foster City, California, USA) and 4 µl of amplicon DNA. Cycle sequencing was performed on an ABI 9700 thermocycler with cycling conditions set as: 94 °C for 5 min followed by 30 cycles of 94 °C for 15 s, 55 °C for 30 s and 68 °C for 2.5 min with a final extension of 68 °C for 3 min. Sequencing fragments were purified using Sephadex G50 resin (Sigma-Aldrich, St Louis, Missouri, USA) before loading on the Applied Biosystems 3500 Genetic Analyzer.
5
Efficient DNA Sequencing of Primate Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
1–2 μL of PCR products were amplified using 5 μM of forward or reverse species-specific primer (PsimEDF or PsimEDR), 0.5 μL of BigDye terminator and 1 μL of BigDye Buffer (Applied Biosystems) for DNA sequencing. In addition, PCR products were sequenced using the primers PsimINF 5′ GCTGGAGATCCTATTTTATATCAAC 3′ (forward) or PsimINR 5′ATGTAAACAATCCAATAATTGCACC 3′ (reverse), with the same PCR conditions, resulting in sequences that covered both SNPs we consider diagnostic of P. simium. The following cycling parameters were used in both situations: 96 °C for 1 min, 35 cycles of 96 °C for 15 sec, followed by the temperature of primer annealing (54 °C) for 15 sec and 60 °C for 4 min. The fragments were precipitated using ammonium acetate, suspended in formamide HI-DI (Applied Biosystems) and electrophoretically separated in ABI 3730 DNA automatic sequencer. Sequences were aligned using ClustalW software in Bioedit package34 and Chromas software35 .
6
Validating PCR-RFLP Results via Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the PCR-RFLP results, SNP No. 13 (Accession No. rs6010620) was also analyzed by Sanger sequencing using a 3130XL Genetic Analyzer (Applied Biosystems, Japan). The thermocycling reactions for direct sequencing comprised 10 μL, containing 5 μL of water, 1.5 μL of 5 × Big Dye buffer, 1 μL of 2.5 × Big Dye version 1.1, 3.1 (Applied Biosystems, USA), 0.5 μL of 3.2 pmol/μL reverse primer, and 2 μL of purified PCR fragment from agarose gel. The thermocycling conditions were as follows: pre-denaturation at 96°C for 1 min; followed by 25 cycles of 96°C for 10 s, 50°C for 5 s, and 72°C for 4 min; and then a hold step at 4°C for an indefinite period. Reaction products were ethanol precipitated and resuspended in HiDi formamide (Applied Biosystems, USA). Products were denatured at 95°C for 3 min followed by chilling on ice for 3 min. Then, samples were mounted on the Genetic Analyzer system to extract nucleotide sequence information by capillary electrophoresis. Finally, results were analyzed using Seq_Scanner software (Applied Biosystems, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!