Nucleofection solution

Manufactured by Lonza

Sourced in Switzerland

Nucleofection solution is a laboratory reagent used for the transfection of DNA, RNA, or other molecules into cells. It is a non-viral method of gene delivery that utilizes an electrical pulse to temporarily permeabilize the cell membrane, allowing the desired molecules to enter the cells.

Automatically generated - may contain errors

Lab products found in correlation

Nucleofector 2 device, by Lonza (2 mentions) Flow cytometry, by BD (1 mentions) Tryple, by Thermo Fisher Scientific (1 mentions) Mouse neuron nucleofector kit, by Lonza (1 mentions) N2 supplement, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Glutamax, by Thermo Fisher Scientific (1 mentions) Genepulser, by Lonza (1 mentions) Amaxa 4d nucleofector, by Lonza (1 mentions) Amaxa human msc nucleofector kit, by Lonza (1 mentions) Trypsin edta, by Merck Group (1 mentions) Phosphate buffered saline (pbs), by Thermo Fisher Scientific (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Sybr green supermix, by Bio-Rad (1 mentions) 4d nucleofector, by Lonza (1 mentions) Genejet genomic dna purification kit, by Thermo Fisher Scientific (1 mentions) Aaf 1002b, by Lonza (1 mentions)

Spelling variants of this product

Nucleofection (130 citations) P1 Nucleofection solutions (6 citations) P3 nucleofection solution (6 citations) Nucleofection solution V (4 citations) SF Nucleofection solution (4 citations) Primary cell nucleofection solution (3 citations) P3 primary nucleofection solution (3 citations) Mouse ES cell nucleofection solution (2 citations) P2 nucleofection solution (2 citations)

7 protocols using nucleofection solution

CRISPR-Cas9 Editing of ARID1A in H9 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed specific guide RNA sequences (sgRNAs) targeting exon 1 of ARID1A on the website (http://crispr.mit.edu). Then, sgRNA were cloned to the PX330‐GFP‐U6 plasmid (a gift from Dr. Haoyi Wang at the Institute of Zoology, Chinese Academy of Sciences) containing the Cas9 protein sequence and guide RNA.
H9 cells at 70–80% confluence were separated into single cells using accutase at 37°C for 4 min. Prior to electroporation, 10 μg gRNA expression plasmid was diluted with Primary cell solution (Lonza) and was first made a nucleofection solution. For each reaction, cells were mixed with the nucleofection solution (Lonza). Nucelofection was performed in a Nucleofector II device (Lonza) using the program CM115. After electroporation, cells were immediately resuspended in an hESC medium with 10 uM Rock inhibitor (Y‐27632) and transferred into a matrigel‐coated 6‐well plate. To measure the targeted editing frequency, cells were screened to obtain GFP‐positive with flow cytometry (BD Bioscience) after 36 h of culture and reseeded as single cells. After approximately 2 weeks, colonies were picked and expanded for genotype sequencing with the following primers to check for integration: Arid1a‐372 bp‐F, 5′‐GGGAGAAGACGAAGACAGGG‐3′, Arid1a‐372 bp‐R, 5′‐CGTTCCCGTTCGAGTTCTTC‐3′.

Liu P., Dai S., Mi T., Tang G., Wang Z., Wang H., Du H., Tang Y., Teng Z, & Liu C. (2022). Acetate supplementation restores cognitive deficits caused by ARID1A haploinsufficiency in excitatory neurons. EMBO Molecular Medicine, 14(12), e15795.

+ Open protocol

+ Expand

Transfecting iPSCs with CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Adherent cells were dissociated using Tryple (Gibco), centrifuged and resuspended in TeSR containing 10µM ROCK inhibitor, Y27632. 1×10⁶ cells were resuspended in 100µl of Lonza® Nucleofection solution (according to manufacturer’s protocol). The following amounts of DNA were added; Cas9 2µg, gRNA 2 µg, PBHR 5µg, pmaxGFP 2µg, and/or PiggyBac Transposase 2.5µg in the required experimental combination. The samples were then nucleofected using the B-16 protocol on the device. After nucleofection, TeSR was added and cells transferred to a 6-well Matrigel-coated plate. After 24–48 hours of incubation, the nucleofected iPSC were split onto 10cm MEF plates at single-cell density for colony screening or harvested for genomic DNA analysis.

Firth A.L., Menon T., Parker G.S., Qualls S.J., Lewis B.M., Ke E., Dargitz C.T., Wright R., Khanna A., Gage F.H, & Verma I.M. (2015). Functional Gene Correction for Cystic Fibrosis in Lung Epithelial Cells Generated From Patient iPSCs. Cell reports, 12(9), 1385-1390.

+ Open protocol

+ Expand

Transfection of Cerebellar Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols

The transfection of the cells was performed using the mouse neuron Nucleofector kit (Lonza, Switzerland) according to manufacturer’s instructions. 100 μl of the Nucleofection solution (Lonza, Switzerland) was mixed with the plasmid DNA to be transfected. This mixture was then used to suspend the cerebellar cell pellet. Cell suspension was transferred into one of the cuvettes provided in the kit and subjected to an optimized program. After transfection, cells were plated in a glass chamber that had been coated with poly-L-lysine containing 90% v/v DFM, 1% N-2 Supplement (GIBCO, Invitrogen), 1% Glutamax (GIBCO, Invitrogen) and 10% v/v FBS (GIBCO, Invitrogen), pH was adjusted to 7.2–7.4. 2 h after transfection, the medium was changed to non-serum conditions and half of the medium was changed once or twice a week.

Shimobayashi E, & Kapfhammer J.P. (2017). Increased biological activity of protein Kinase C gamma is not required in Spinocerebellar ataxia 14. Molecular Brain, 10, 34.

+ Open protocol

+ Expand

Efficient Genome Editing via Electroporation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electroporation was performed using either a BioRad GenePulser Xcell Electroporation (#1652660) or a Lonza Amaxa 4D Nucleofector (Lonza #AAF-1002B) with the corresponding X unit (Lonza #AAF-1002X). 1 × 10⁶ cells were resuspended in 100 μL of Nucleofection Solution (Lonza) along with 2 μg of guide DNA (pX330 expression plasmid containing a single guide RNA) or 1 μg of pMAX. pMAX was utilized as a nucleofection control containing a sequence for a green fluorescent protein (GFP). Cells were placed in cuvettes with a gap width of 0.4 cm as recommended by the manufacturers for mammalian cells. BioRad cuvettes (BioRad #1652081) were used with the BioRad GenePulser and Lonza cuvettes were used with the Amaxa 4D Nucleofector (Lonza #V4XC-2012). The K562 and Jurkat nucleofection presets were used to deliver the electrical pulse. Successful delivery of plasmid DNA was assessed by analyzing the positive control containing pMAX via flow cytometry 72 h after nucleofection.

Björnson Y., Huang C.Y., Rollins J.L., Castañeda G., Kaur N., Yamamoto E, & Johnston J.M. (2023). The effect of histone deacetylase inhibitors on the efficiency of the CRISPR/Cas9 system. Biochemistry and Biophysics Reports, 35, 101513.

+ Open protocol

+ Expand

Nucleofection for Efficient Plasmid Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cell nucleofection, the Amaxa Human MSC Nucleofector Kit was used (Lonza, Basel, Switzerland). Cells were washed with PBS (GIBCO) then lifted with 0.25% Trypsin–EDTA (Sigma, St Louis, MO) and counted and aliquoted at 1 × 10⁶ cells per 15 ml conical tube. 2 mL of DMEM (GIBCO) with 20% FBS was placed in 6-well plates and pre-warmed in a 37 °C incubator. Cells were resuspended in 100 μl nucleofection solution (Lonza) and 10 μg of BMP-6 plasmid was added to the solution and placed in a cuvette. The cuvette was placed in the Nucleofector II device (Lonza) and set to program G-22. After nucleofection, cells were immediately pipetted out of the cuvette and into the 6-well plate with pre-warmed media. The final concentration in each well was 2 × 10⁶ cells. The next morning the cells were lifted as described above, counted, and used for the preparation of cell-seeded bio-inks.

Glaeser J.D., Bao X., Kaneda G., Avalos P., Behrens P., Salehi K., Da X., Chen A., Castaneda C., Nakielski P., Jiang W., Tawackoli W, & Sheyn D. (2022). iPSC-neural crest derived cells embedded in 3D printable bio-ink promote cranial bone defect repair. Scientific Reports, 12, 18701.

+ Open protocol

+ Expand

CRISPR-Based Genome Editing Monitoring in HAP1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human HAP1 cells expressing cDNA encoding C-terminally Strep-tagged SPRTN variants cells were electroporated with NLS-Cas9/gRNA RNPs using a 4D-Nucleofector (Lonza). In brief, crRNA1 and crRNA2 are incubated with tracRNA (95°C, 5 minutes), respectively, to generate gRNAs. gRNAs were mixed with NLS-Cas9 and incubated for 10 minutes at RT to generate RNPs. 1x10⁶ cells were resuspended in 20 μl Nucleofection Solution (Lonza, SE. Cell line 4D-Nucleofector X Kit). Suspended cells were then mixed with RNPs and electroporated (program EN-138). Cells were plated and samples collected every 48 hours after electroporation for genomic DNA extraction (GeneJET Genomic DNA purification kit, Thermo Scientific). The relative amount of KO and WT allele was monitored for each cell line at each time point by qPCR analysis. Each 10 μl reaction contained 20 ng genomic DNA, 0.4 μl forward and reverse primer (10 μM) and 5 μl SYBR Green Supermix (Bio-Rad). PCR reaction was performed in technical triplicates using primers amplifying either WT or KO allele. For analysis, Cq^WT was subtracted from Cq^KO to obtain ΔCq. 2^-(ΔCq) was calculated for each time point and normalized to the day 2 value (2^-(ΔΔCq)).

Reinking H.K., Kang H.S., Götz M.J., Li H.Y., Kieser A., Zhao S., Acampora A.C., Weickert P., Fessler E., Jae L.T., Sattler M, & Stingele J. (2020). DNA Structure-Specific Cleavage of DNA-Protein Crosslinks by the SPRTN Protease. Molecular Cell, 80(1), 102-113.e6.

+ Open protocol

+ Expand

CXCR6-Specific RNP Complex for MAIT Cell Modification

Check if the same lab product or an alternative is used in the 5 most similar protocols

To create a CXCR6-specific RNP complex, oligos crRNA_CXCR6_AA (100 pmole) and tracrRNA (100 pmole) were first annealed using a slow ramp reaching 23°C and incubated at room temperature 10 min with 10 μg S.p Hifi Cas9 Nuclease V3. 2.106 (all reagents from IDT). Expanded MAIT cells were transfected according to the manufacturer instruction (Lonza). Briefly, 2 x 10⁶ cells were resuspended in nucleofection solution (Lonza) with 3 μl RNP complex, transferred to nucleofection cuvette strips, electroporated using the DN110 program (4D-Nucleofector Core Unit: Lonza, AAF-1002B) and incubated in complete RPMI 1640 media at 32 °C for 24 hours to force non homologous repair recombination. Transfected cells were further cultured for 2-3 days before transfer. The efficiency of Cxcr6 deletion was evaluated for each experiment on the day of injection by flow-cytometry.

du Halgouet A., Darbois A., Alkobtawi M., Mestdagh M., Alphonse A., Premel V., Yvorra T., Colombeau L., Rodriguez R., Zaiss D., El Morr Y., Bugaut H., Legoux F., Perrin L., Aractingi S., Golub R., Lantz O, & Salou M. (2023). Role of MR1-driven signals and amphiregulin on the recruitment and repair function of MAIT cells during skin wound healing. Immunity, 56(1), 78-92.e6.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!