Pgem t

For transgenic expression of GFP-MPK10 fusion protein, the gene encoding the L. major MAPK homologue LmaMPK10 (accession number CAJ02415) was PCR amplified from 50 ng of genomic DNA of L. major FVI using primers 5′-ACCAGATCTCCACCATGCAGGCCAAGGGC-3′ (forward) and 5′-GCGAGATCTTCACGACGGGGCCGGCGC-3′ (reverse) and cloned into pGEM-T (Promega) to obtain pGEMT-MPK10. This plasmid was subsequently digested by BglII and subcloned into pXG-GFP+2 to generate pXG-GFP-MPK10 (kindly provided by S. Beverley, Washington University Medical School, St. Louis, MO, USA). The various MPK10 mutants described in the results section were obtained by site direct mutagenesis of pGEMT-MPK10 using the QuickChange II XL Site-Directed Mutagenesis kit (Stratagene) prior to subcloning into pXG-GFP2+. MPK10-ΔC was PCR amplified with primers 5′-ACCAGATCTCCACCATGCAGGCCAAGGGC-3′ (forward) and 5′-GCGAGATCTTCAGTCGTTGAAGCGCTCC-3′ (reverse) containing a stop codon to generate a protein deleted for the last 46 amino-acids (138 nucleotides) from the C-terminal end of LmaMPK10, and was cloned into pXG-GFP2+ as described above to generate the pXG-GFP-MPK10-ΔC construct. All constructs were validated by sequence analysis.

The pGEM-T (Promega, Madison, WI, USA) and pGEM-T Easy vectors were used to clone PCR-amplified DNA segments. We used the psGFP (S65T) expression vector which carries a modified green fluorescent protein (GFP) gene sGFP (S65T) under the control of the cauliflower mosaic virus 35S promoter; CaMV35S [48 (link)]. To clone the suppressing version of OsY37, we used the plasmids pActSRDXG and p35SSRDXG carrying rice actin, Act1 promoter, and CaMV35S promoter respectively together with the transcription factor repression domain; SRDX comprising amino acid residues, GLDLDLELRLGFA. The japonica OsY37^N full-length clone in the vector pME18SFL3, was obtained from the National Institute of Agrobiological Sciences (http://www.dna.affrc.go.jp/jp/). Versatile plant binary vector, pIG121Hm, confers hygromycin resistance (Hgr^R) to rice plants and Agrobacterium tumefaciens [49 (link)] and kanamycin resistance to A. tumefaciens and Escherichia coli. Primers used in the present report are listed in Table 1.

The coding region of the genes selected for qRT-PCR validation of the RNA-Seq data were cloned into pGEM-T (Promega). PCR was performed with 1X ThermoPol Buffer, 200 µM dNTP, 1.25 units/ 50 µL of Taq Polymerase, 0.2 µM of each primer (Table S4), and P. stewartii DC283 chromosomal DNA template. Thermocycler settings per enzyme protocol (New England Biolabs) were denaturation at 95 °C for 30 s, annealing for 60 s at the appropriate temperature (Table S4), and extension at 68 °C for 30 s, performed for 30 cycles. The final extension was 68 °C for 5 min. The PCR products were visualized on a 1% agarose gel, and extracted using a Gel Extraction Kit (Qiagen). Fragments were modified by addition of dATP via Taq polymerase and a PCR Purification Kit (Qiagen) was used to remove additional dATPs. This PCR product was then ligated into the pGEM-T vector (Promega, Madison, WI, USA) and the resulting plasmid was transformed into E. coli Top 10 (Table S1). Plasmids containing the coding regions were screened via PCR and sequenced (VTBI) to confirm the construct.

A nested PCR was used to test for the presence of ILTV DNA in TG collected on 21 dpv, TG co-culture supernatants and selected swabs collected on 21 dpv. Conjunctival mucosa, palatine cleft, infraorbital sinus and tracheal swabs were only tested for the presence of ILTV DNA using the nested PCR if the swabs collected 21 dpv tested negative for ILTV DNA using the less sensitive UL15 qPCR, and if the TG sample from the same individual bird was positive for ILTV using the nested PCR. This nested PCR, the universal herpes virus (UHV) nested PCR, targets a conserved region of the herpes virus DNA polymerase gene [38 (link)]. Products amplified during the second round of this PCR were purified using QIAquick Gel Extraction Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. Depending on the yield of purified DNA, amplicons were either directly subjected to sequencing or cloned into pGEM-T (Promega) following manufacturer’s instructions before sequencing. Sequencing reactions were performed using Big Dye Terminator v3.1 (Life Technologies Corporation, Carlsbad, USA) according to manufacturer’s instructions. Sample electrophoresis and sequencing was performed at the Centre for Translational Pathology, University of Melbourne. Geneious software version 9.1.3 [39 (link)] was used to analyse the sequencing data.

Mouse embryonic stem cells were electroporated (Lonza nucleofection) per the manufacturers protocol with px458-mCherry^{56 (link)} carrying Cas9 and a single sgRNA targeting the C-terminus of Sox2 (TGCCCCTGTCGCACATGTGA) as well as two linearized pGEM-T (Promega) donors containing either GFP or BFP and 1 kb homology arms. GFP/BFP double positive cells were single- cell sorted by FACS and clonally selected.

Dried crude herbs (Chaihu-Shugan-San, CSS) were purchased and identified in the pharmacy of Xiangya Hospital (Changsha, China). Voucher specimens (CH-NO-15021714, BS-NO-15021411, CP-NO-15020914, XF-NO-15021118, CX-NO-15022413, ZK-NO-15020706, GC-NO-15022715) were obtained and kept in the Laboratory of the Institute of Integrative Medicine, Central South University. Glycyrrhetinic acid (GA) was purchased from the Beijing Hengyuan Qitian Chemical Industry (Beijing, China). Rifampicin (RIF), pregnenolone 16α-carbonitrile (PCN), dimethyl sulfoxide (DMSO), and phenobarbital (PB) were obtained from Sigma-Aldrich (St. Louis, MO, USA). The reverse transcription system, dual-luciferase reporter assay system, pGL4.17-Luc, and pGEM-T constructs were supplied by Promega (Madison, WI, USA).