Total RNA was isolated from cells using the TRIzol reagent (Tiangen), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO) following the manufacturer’s instructions. PCR amplification was performed using the SYBR Green PCR master mix Kit (TOYOBO). All quantitations were normalized to the level of endogenous control GAPDH.
Sybr green pcr master mix kit
Manufactured by Toyobo
Sourced in Japan, United States
SYBR Green PCR Master Mix kit is a ready-to-use solution for real-time polymerase chain reaction (PCR) experiments. It contains all the necessary reagents, including SYBR Green dye, for efficient and reliable gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (13 mentions)
Superscript rt kit, by Toyobo (9 mentions)
Trizol reagent, by Tiangen Biotech (7 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Hipure total rna mini kit, by Magen Biotechnology Co (3 mentions)
Revertra ace qpcr rt kit, by Toyobo (3 mentions)
Reverse transcription kit, by Promega (2 mentions)
7300 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Toyobo (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Cfx96, by Bio-Rad (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Cfx96tm real time system, by Bio-Rad (1 mentions)
Revertra acetm qpcr rt master mix with gdna remover, by Toyobo (1 mentions)
Rnase free dnase, by Promega (1 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
30 protocols using sybr green pcr master mix kit
1
Total RNA Isolation and qPCR Analysis
2
Quantifying IL-6 mRNA Expression in Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared with a Hipure Total RNA Mini Kit (Magen, Guangzhou, China). ReverTra Ace qPCR RT kit (TOYOBO Co., Ltd., Osaka, Japan) was used to synthesize cDNA. Quantitative PCR was carried out using the SYBR green PCR master mix kit (TOYOBO Co., Ltd., Osaka, Japan) on the StepOnePlus realtime PCR system (ThermoFisher Scientific, CA, U.S.). Quantitation of IL-6 mRNA was normalized to GAPDH by the ΔΔCt method. The primers were rat IL-6: forward: 5′-ACTTCCAGCCAGTTGCCTTCTTG-3′, reverse: 5′-TGGTCTGTTGTGGGTGGTATCCTC-3′; rat GAPDH: forward: 5′-AGGTCGGTGTGAACGGATTTG-3′, reverse: 5′-TGTAGACCATGTAGTTGAGGTCA-3′.
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tissue specimen ground in liquid nitrogen or the cultured cells were homogenized in Trizol (Invitrogen, Carlsbad, CA, USA). The total RNA was converted to cDNA by using reverse transcription kits (Promega, Madison, WI, USA). All primers were synthesized by Shanghai Shine Gene Company. The sequences of the primers used in this study are indicated in Table 2 . Quantitative RT-PCR was then performed using a SYBR Green PCR Master Mix kit (Toyobo, Osak, JAPAN) according to the manufacturer's protocol. Amplification of β-actin was performed in parallel as a relatively invariant internal reference. The 2−ΔΔCt method was applied for data analysis.
4
Quantifying Skeletal Muscle Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the 8 skeletal muscle samples was extracted using TRIzol reagent (Invitrogen, Carsbad, CA, USA). Reverse transcription was performed using M-MLV reverse transcriptase (Invitrogen). qPCR was carried out in a CFX96 Bio-Rad (Bio-Rad, USA) device using the SYBR Green PCR Master Mix kit (Toyobo, QPK201, Japan). Relative gene expression levels were calculated by 2−ΔΔCt method. Levels of the α-tubulin mRNA were used as internal control. All of the qPCR primers used in this study are listed in Supplementary Table 3 . T-test was conducted to analyze the statistical significance of differences between low and high- FE pigs. Significance level was set at P < 0.05.
5
Quantifying BTG2 mRNA Expression in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from MCF-7 cells or breast cancer/paracarcinoma tissues, according to the manufacturer's protocol. The extracted RNA was reverse transcribed into cDNA using a PrimeScript RT Reagent Kit with gDNA Eraser (cat. no. RR047A; Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. Subsequently, SYBR Green PCR Master Mix kit (Toyobo Life Science) was used for PCR-mediated amplification. Relative mRNA expression was calculated using the 2-ΔΔCq method (39 (link)). The primer sequences used for qPCR were as follows: BTG2-forward (F), 5'-CATCATCAGCAGGGTGGC-3'; BTG2-reverse (R), 5'-CCAATGCGGTAGGACACC-3'; β-actin-F, 5'-CTTAGTTGCGTTACACCCTTTCTTG-3'; and β-actin-R, 5'-CTGTCACCTTCACCGTTCCAGTTT-3'. The reactions were performed using the following thermocycling conditions: Initial denaturation at 95˚C for 5 min, followed by 32 cycles of 95˚C for 30 sec, 56˚C for 40 sec and 72˚C for 40 sec. All quantifications were normalized to the internal reference gene β-actin.
6
CAR Gene Copy Number Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T cells were collected, and total DNA was extracted using a gDNA extraction kit (Takara, Japan). The copies number of CAR genes was analyzed by RT-PCR. The reaction was carried out using a SYBR Green PCR Master Mix Kit (Toyobo, Japan) according to the manufacturer’s instructions. The relative expression level was normalized to that of β-actin and calculated using the 2−ΔΔCt method.
7
Quantitative PCR Analysis of SIRT1 in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples from cultured HUVECs were isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols. Total RNA (1 µg) was then reverse transcribed using the High-Capacity cDNA Reverse Transcription kit (Toyobo Co., Ltd., Osaka, Japan) to obtain cDNA, with the following temperature protocol: 37°C for 15 min, then 98°C for 5 min. The SYBR Green PCR Master Mix kit (Toyobo Co., Ltd.) was used for qPCR to quantify RNA levels of silent information regulator 1 (SIRT1). GAPDH served as an internal control. qPCR was performed on the 7300 FAST Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) for 40 cycles. The thermocycling conditions were as follows: 95°C for 10 min followed by 95°C for 15 sec, then 40 cycles of 60°C for 30 sec and 72°C for 30 sec. The results were quantified using the 2−ΔΔCq method (15 (link)). Primer sequences were as follows: Akt, forward, 5′-GGTGATCCTGGTGAAGGAGA-3′ and reverse, 5′-CTTAATGTGCCCGTCCTTGT-3′; mTOR, forward, 5′-TTCTGGTGCGACACCGAATC-3′ and reverse 5′-CATCGGGTTGTAGGCCTGTG-3′; TGF-β1, forward, 5′-CCCCGAGGGCGGCATG-3′ and reverse, 5′-CATGCCGCCCTCGGGG-3′; p53, forward, 5′-ACGACGGTGACACGCTTCCCTG-3′ and reverse, 5′-CGCTAGGATCTGACTGCGGCTC-3′; and GAPDH, forward, 5′-GCTCTCTGCTCCTCCTGTTC-3′ and reverse, 5′-ACGACCAAATCCGTTGACTC-3′.
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from transiently transfected cells using the TRIzol reagent (Tiangen, Shanghai, China), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO, Osaka, Japan), according to the manufacturer's instructions. PCR amplification was performed using the SYBR Green PCR master mix Kit (TOYOBO). All quantization were normalized to the level of endogenous control GAPDH.
9
Gene Expression Analysis in Cardiac Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen tissues and cultured cells using a Hipure Total RNA Mini kit (Magen) as the manufacturer's instructions. cDNA synthesis was performed using ReverTra Ace qPCR RT kit (TOYOBO Co., Ltd) following the manufacturer's instructions. A SYBR green PCR master mix kit (TOYOBO Co., Ltd) was used to perform real‐time quantitative reverse transcription polymerase chain reaction (qPCR) on StepOnePlus real‐time PCR system (Applied Biosystems, ThermoFisher Scientific). GAPDH was used as control and the 2ΔΔCt method for data analysis. Primer sequences are listed as follows. mouse BNP: Forward CTGAAGGTGCTGTCCCAGAT, Reverse CCTTGGTCCTTCAAGAGCTG. mouse Col1A1: Forward TGAACGTGGTGTACAAGGTC, Reverse CCATCTTTACCAGGAGAACCAT. mouse Col3A1: Forward GCACAGCAGTCCAACGTAGA, Reverse TCTCCAAATGGGATCTCTGG. mouse Periostin: Forward AACCAAGGACCTGAAACACG, Reverse TGTGTCAGGACACGGTCAAT. mouse IL‐6: Forward CTCCCAACAGACCTGTCTATAC, Reverse CCATTGCACAACTCTTTTCTCA. mouse MMP2: Forward TGGCACCACCGAGGACTATGAC, Reverse ACACCACACCTTGCCATCGTTG. mouse GAPDH: Forward AGGTCGGTGTGAACGGATTTG, Reverse TGTAGACCATGTAGTTGAGGTCA. rat ANP: Forward GAGCGAGCAGACCGATGAAGC, Reverse TCCATCTCTCTGAGACGGGTTGAC. rat BNP: Forward AGCTCTCAAAGGACCAAGGC, Reverse TCTGCCCAAAGCAGCTTGAA. rat GAPDH: Forward GACATGCCGCCTGGAGAAAC, Reverse AGCCCAGGATGCCCTTTAGT.
10
Total RNA Isolation and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using the TRIzol reagent (Tiangen), and cDNA was reversed-transcribed using the Superscript RT kit (TOYOBO) following the manufacturer’s instructions. PCR amplification was performed using the SYBR Green PCR master mix Kit (TOYOBO). All quantitations were normalized to the level of endogenous control GAPDH. The sequences of Primers for qRT-PCR were listed in Additional file 2 : Table S1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!