Nanodrop 2000 spectrophotometry

Total RNA was extracted from GM-CSF-polarized macrophages (4 × 10⁶) using the RNeasy minikit (Qiagen) according to the manufacturer’s instructions. Quality and yield of RNA were determined by agarose gel electrophoresis and NanoDrop 2000 spectrophotometry (ThermoFisher Scientific), respectively. cDNA was synthesized using the Moloney murine leukemia virus reverse transcriptase kit (M-MLV RT; Invitrogen), and expression of the IL-12-encoding genes (p35 and p40) was determined by qPCR using an Applied Biosystems 7500 system by calculation of the delta-delta threshold cycle (ΔΔC_T) method normalized against the beta-actin housekeeping gene, as described previously (42 (link)).

We collected a series of samples in three replicates to isolate total RNA to cover developmental periods before and after the primary sex-determination event in embryos. Samples include ~200 embryos collected at each stage (i.e., 0–1 h, 2–4 h, 4–8 h, and 8–12 h post-oviposition), along with 15 sex-mixed pupae, 15 male adults, and 15 female adults. RNA concentrations and purity were determined initially by Nanodrop 2000 spectrophotometry (Thermo Fisher Scientific, USA). Samples of OD260:280 > 2.0 were submitted to BGI Tech for further quality control using the Agilent 2100 Bioanalyzer. A RIN (RNA integrity number) value >8.0 was met to process library construction. Libraries were constructed and sequenced with 150 bp paired ends on BGISEQ-500 (MGI, Shenzhen, China), yielding a total of 718,007,728 reads (each sample >20 million reads). All RNA-seq reads were input to Trinity assembler v2.11.0^{36 (link)} to run a de novo assembly with default parameters to create the transcriptome. Based on the assembled transcriptome, transcript levels were quantified and normalized to TMM (trimmed mean of M-values) using the abundance_estimates_to_matrix.pl scripts available in the trinity toolkit^{36 (link)}. The resulting data were submitted to the NCBI SRA database (PRJNA834573).

To assess sgRNA efficiency in vivo, 100 embryos were injected with a Cas9-gRNA mixture. Of these 24 hatched and their genomic DNA and that of three wild-type Orlando larvae were individually extracted by DNeasy Tissue and Blood Kit (Qiagen, Hilden, Germany). The concentration and purity of genomic DNA was measured in a Nanodrop 2000 spectrophotometry (Thermo Fisher Scientific, Waltham, MA, USA). High resolution melt analyses were performed by Precision Melt Supermix (Bio-Rad, Hercules, CA, USA) using optimized forward (GTACTAACTCAACTTTATGGC) and reverse (GGCATTTTCCCCCCAACCTG) primers. In 10μL reaction was included with 1 μL of primer (2 μM), 4 μL of genomic DNA (50 ng) and 5 μL of Precision Melt Supermix. Real time PCR was run in Bio-Rad’s CFX 96 under the following conditions: one cycle of 95 C, 2 min; 40 cycles of 95 C, 10 sec, 60 C, 30 sec and 72 C, 30 sec; 1 cycle of 95 C, 30 sec, 60 C, 1 min and 65–95 C in 0.2 C increments, 10 sec/step. The generated data files were imported into Precision Melt Analysis software for HRM analysis based on the thermal denaturation properties of double-stranded DNA. The normalized melt curves were grouped with the wild-type samples as references.

Total RNA was isolated from pooled EBISs from each mouse using TRIzol reagent (Catalog# 15596026, Life Technologies, Carlsbad, CA, USA). The quantity of all preparations was determined by NanoDrop 2000 spectrophotometry (Thermo Fisher Scientific). About 1 µg of total RNAs after removal of genomic. First-strand cDNA was synthesized using SuperScript™ VILO™ cDNA Synthesis Kit (Catalog# 11754-050, Invitrogen by Thermo Fisher Scientific). RT-PCR was performed using a CFX96^TM Real-Time System (Bio-Rad, Hercules, CA, USA) and PowerUp SYBR Green Master Mix (Catalog# A25742, Applied Biosystems by Thermo Fisher Scientific). The conditions used for qPCR were as follows: 95 °C for 2 min followed by 39 cycles of 95 °C for 15 s, 55 °C for 30 s and 60 °C for 1 min. All reactions were run in triplicate. The primers used for qPCR are listed in Table S2. The 2^−∆∆Ct method was used to quantify relative gene expression using the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) housekeeping gene as an internal control [81 (link)] and expressed as fold change relative to expression in the vehicle group. The values reported are the mean (±SD) of three replicates.

TRIzol tries to extract total RNA with reagent according to the instructions. NanoDrop 2000 spectrophotometry(Thermo Scientific, USA) was used to measure and evaluate RNA purity and quantification. The Agilent 2100 bioanalyzer(Agilent Technologies, Santa Clara, CA, USA) was used to assess RNA integrity. Then the truseq mRNA LT sample was used to prepare the kit in accordance to the instructions. OE Biotechnology Ltd. (Shanghai, China)performed transcriptome sequencing and analysis.

Genomic DNA was extracted from leaves according to a modified CTAB method described by Murray and Thompson (1980) (link) and adjusted to a final concentration of 25 ng/μL after quantification using a Nanodrop 2000 spectrophotometry (Thermo Scientific, United States). The DNA quality was further confirmed by 1.5% agarose gel electrophoresis at 90 V for 30 min.
The mutants were characterized by triple-primer PCR (polymerase chain reaction) (Figure 1). Reaction system (20 μL) contained ∼50 ng template DNA and 0.4 μM of each primer in 2 × Taq Master Mix (TOYOBO, Japan). The PCR program used included a hot start of 5 min at 94°C followed by 30 cycles of 45 s denaturation at 94°C, 45 s at 60°C (ND6011 for 58°C) annealing, 1 min polymerization at 72°C, and concluded by 10 min at 72°C. PCR products were detected by 1.5% agarose gel electrophoresis. Forward primer (FP) and reverse primer (RP) (Supplementary Table 1) at upstream and downstream of the Tos17 insertion position were designed using the NCBI software³. Tos17 insertion position primer (TP) (Supplementary Table 1), a specific sequence primer located at the conjunction of rice genome with the inserted Tos17, was adopted from the Gramene data resource⁴.