Total RNA was extracted from cultured cells using the RNeasy kit (Qiagen, Cat. # 217004) in accordance with the manufacturer's instructions. cDNA was synthesized from 0.5–1.0 μg total RNA using Superscript II Reverse Transcriptase (Invitrogen, Cat. # 18080044). Then, qRT-PCR was performed in triplicate with the ABI PRISM 7900HT sequence detection system (ABI) using SYBR green (Genecopoeia, Cat. # QP005). Relative mRNA levels were calculated and normalized to 18S rRNA. The primers were used as follows: CD5L forward 5'-TTGGAGAACAACTGTACCCATGGC-3', reverse 5'-AGGCTGAGGGAAAGGTGTCTAAAG-3'; Bcl2a1b forward 5'-GTTTCCAGTTTTGTGGCAGA-3', reverse 5'-CCCAGAACTGTCCTGTCATC-3'; MRPS18C forward 5'-GCATTTATGGAAGGCACATAAC-3', reverse 5'-TGGCAGGAACTTCACAAATAC-3'; 18S rRNA forward 5'-GCAATTATTCCCCATGAACG-3', reverse 5'-GGCCTCACTAAACCATCCAA-3'. Directional polyA RNA-sequencing was performed by the Genomics, Epigenomics, and Sequencing Core (GESC) at the University of Cincinnati.
Sybr green
Manufactured by GeneCopoeia
Sourced in United States
SYBR Green is a fluorescent dye that binds to double-stranded DNA. It can be used for DNA quantification and real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
7500 real time pcr machine, by Thermo Fisher Scientific (2 mentions)
Quantstudio 6 flex system, by Thermo Fisher Scientific (2 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Universal rt microrna pcr system, by GeneCopoeia (1 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
All in one qpcr mix, by GeneCopoeia (1 mentions)
Iq5 real time pcr detection system, by Bio-Rad (1 mentions)
Primescript rt pcr kit, by Takara Bio (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay kit, by Thermo Fisher Scientific (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Mirneasy or rneasy mini kit, by Qiagen (1 mentions)
Cdna synthesis kit, by GeneCopoeia (1 mentions)
13 protocols using sybr green
1
Quantifying mRNA Expression by qRT-PCR
2
Profiling miRNA Expression in Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Universal RT miRNA PCR system (GeneCopoeia, USA) was used to profile the miRNAs in the two pooled tissue samples (ie, 25 tumors and 25 matched normal controls). The profiling assay consisted of universal reverse transcription (RT) and sequential qRT–PCR amplification with special primers using SYBR Green (GeneCopoeia, USA).
3
IRGM mRNA Expression Analysis via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s guidelines, total RNA was extracted using Trizol reagent (Invitrogen). Then, 2 μg total RNA was reverse transcribed into 20ul cDNA using Reverse Transcription kit (Thermo) according to the manufacturer’s protocol. cDNA samples were subjected to real-time PCR(Bio-Rad iQ5) by using SYBR green (Gene Copoeia Inc.). GAPDH was used as an internal control for the expression of IRGM mRNA. The primers used are shown in S1 Table . To determine the IRGM mRNA levels, the following conditions were used: 94°C for 5 min, followed by 40 cycles of 94°C for 10 s, 55°C for 20 s and 72°C for 30 s. All samples were run in triplicate and data analysis was performed using the 2−ΔΔCt method.
4
RNA Extraction and qRT-PCR Analysis
5
miRNA Profiling of Tumor and Normal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Universal RT microRNA PCR system (GeneCopoeia, USA) was used to profile the miRNAs of the two pooled tissue samples (ie, 50 tumors and 50 matched normal controls). The profiling assay consisted of universal reverse transcription (RT) and sequential qRT-PCR amplification with special primers using SYBR Green (GeneCopoeia, USA).
6
Quantifying Cartilage LncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cartilage tissue was reverse-transcribed into cDNA using SuperScript IV reverse transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). Two lncRNAs were then randomly selected for RT-qPCR using SYBR green (Gene Copoeia Inc., Rockville, MD, USA). GAPDH was used as an internal reference gene. The experimental conditions of the PCR amplification were set as follows: 94 °C for 5 min, followed by 40 cycles at 94 °C for 10 s, 55 °C for 20 s, and 72 °C for 20 s. The lncRNAs’ expression levels were calculated with the 2−ΔΔCt method. Three replicates were used for each group.
7
Quantifying RNA Expression in Ovarian Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ovarian cancer cell lines, using an RNA prep pure Plant Kit (Tiangen Biotech Co., Ltd). First-strand cDNA was synthesized using a PrimeScriptTM RT-PCR Kit (TaKaRa Biotechnology Co., Ltd). HOTAIR or MAPK1 mRNA expression levels were examined by quantitative real-time PCR with the iQ5 Real-Time PCR Detection System (Bio-Rad, Hercules, CA) and All-in-One qPCR Mix (GeneCopoeia, Inc.). β-actin values were used for normalization. Primers used for SYBR Green assay were purchased from GeneCopoeia, Inc. (HQP054911, HQP016381). PCR amplifications were started with a 10-min denaturation step at 95°C, followed by 40 amplification cycles (10 s at 95°C, 20 s at 60°C, and 10 s at 72°C). Relative quantification of mRNA was performed using the comparative threshold cycles (CT) method. For detecting miR-1, miR-214-3p, or miR-330-5p, reverse transcription was performed following GeneCopoeia protocol U6 snoRNA validated as the normalizer. The primers were purchased from GeneCopoeia. The value was used to plot the gene expression employing the formula 2−ΔΔCT.
8
Real-Time Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was treated with DNase I (Invitrogen), and then reverse-transcribed using random hexamers at 37°C with the M-MLV reverse transcriptase (Promega, Madison, USA). Real-time quantitative RT-PCR was performed using SYBR Green (GeneCopoeia, USA) in a Real-time PCR machine (QuantStudio 6 Flex System, Applied Biosystems, Foster City, CA). Primers for qRT-PCR are synthesized based on the publication 22 (link), except N-cadherin forward primer (5' CCACCTACAAAGGCAGAAGAGA 3'). GAPDH was used as a reference and amplified with following primer pairs: 5'GAAGGTGAAGGTCGGAGTC 3' and 5' GAAGATGGTGATGGGATTTC 3'. The relative levels of gene expression were calculated as ΔCt = Ct(gene) - Ct(reference). The 2-ΔΔCt method was used to calculate the fold-change of gene expression.
9
Gene and microRNA Expression Analysis
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells with TRIzol reagent and isolated with columns (BBI, B511321, China). A cDNA synthesis kit (GeneCopoeia, QP006, USA) was used to perform reverse transcription. qRT-PCR was performed in a QuantStudio™6Flex system (Thermo Fisher, USA) using SYBR® Green (GeneCopoeia, QP001, USA). The relative expression of target genes was normalized to that of GAPDH, and the 2−ΔΔCt method was used to calculate the fold changes. The sequences of primers used in this study are listed in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!