Hek293t

HEK293T, TZM-bl, and CEM-SS cell lines were obtained from the American Type Culture Collection. HEK293T and TZM-bl cell lines were maintained in Dulbecco's modified Eagle's medium and CEM-SS cell line was maintained in RPMI 1640 medium (Corning Cellgro). Both media were supplemented to contain 10% fetal calf serum (Hyclone), 100 IU/ml penicillin and 100 μg/ml streptomycin (GIBCO).
A3G-P210R mutant was generated by site-directed mutagenesis (QuickChange Lightening site-directed mutagenesis kit, Agilent Technologies) using the following primers: P210R_sense: 5’ATTCACTTTCAACTTTAACAATGAACGGTGGGTCAGAGGAC3’ P210R_antisense: 5’GTCCTCTGACCCACCGTTCATTGTTAAAGTTGAAAGTGAAT3’.
All viruses were prepared using a previously described HIV-1 vector pHDV-eGFP pseudotyped by co-transfecting with phCMV-G plasmid, which expresses vesicular stomatitis virus glycoprotein (VSV-G) [42 (link), 53 (link)–58 (link)]. Briefly, we co-transfected pHDV-eGFP (1.0 μg), pHCMV-G (0.25 μg), and either 0.34 μg or 0.67 μg of pFlag-WT-A3G or pFlag-P210R-A3G expression plasmids in the presence or absence of pcDNA-hVif using polyethylenimine (PEI) as previously described [42 (link), 53 (link)–55 (link)]. Virus-containing supernatant was clarified by filtering through a 0.45-μm filter and kept at -80°C until use.

HEK 293T, CEM, and MOLT4 cells were obtained from the American Type Culture Collection (ATCC). De-dentified patient samples were provided by Loma Linda University (Loma Linda, CA), Penn State College of Medicine (Department of Pediatrics Developmental Therapeutics and Preclinical Core (DTPC)), and Penn State Cancer Institute collected under an approved material transfer agreement (MTA) and after approval from institutional review board (IRB). CEM, MOLT4, and primary T-ALL cells were cultured or maintained in RPMI 1640 medium (Corning) supplemented with 10% fetal bovine serum (Hyclone) and incubated at 37 °C in a humidified atmosphere of 5% carbon dioxide. HEK 293T cells were cultured in Dulbecco’s Modified Eagle Medium -DMEM (CellGro) supplemented with 10% fetal bovine serum (FBS).

The cell lines HEK293T and VCaP were purchased from ATCC (Manassas, VA). BPH-1 cells were kindly provided by Dr. Donald Tindall (Mayo Clinic). HEK293T cells were cultured in Dulbecco's modified Eagle's medium (Corning cellgro) supplemented with 10% FBS (Thermo Fisher Scientific, Cat# 10437028). VCaP cells were cultured in Dulbecco's modified Eagle's medium (Corning cellgro) supplemented with 13% FBS (Thermo Fisher Scientific, Cat# 10437028). BPH-1 cells were cultured in RPMI 1640 medium (Corning cellgro) supplemented with 10% FBS (Thermo Fisher Scientific, Cat# 10437028). Transfections were performed using Lipofectatmine2000 (Thermo Fisher Scientific) or by electroporation using an Electro Square Porator ECM 830 (BTX) with Mirus Ingenio solution, following manufacturer's instructions. Approximately 75–90% transfection efficiencies were routinely achieved, verified by expression of GFP co-transfected with the plasmid(s) of interest.