Log In Sign up
The largest database of trusted experimental protocols

Rch acv

Manufactured by Leibniz Institute DSMZ
Visit Supplier
Sourced in Germany

The RCH-ACV is a laboratory equipment designed for the high-throughput analysis of volatile compounds. It utilizes automated headspace sampling coupled with gas chromatography-mass spectrometry (GC-MS) for the identification and quantification of volatile analytes in various sample matrices.

Automatically generated - may contain errors

Lab products found in correlation

Kasumi 2, by Leibniz Institute DSMZ (3 mentions) U937 cells, by American Type Culture Collection (2 mentions) Hek293t, by American Type Culture Collection (2 mentions) Rs4 11, by Leibniz Institute DSMZ (2 mentions) Nalm 6, by Leibniz Institute DSMZ (2 mentions) Rs4 11, by American Type Culture Collection (2 mentions) Universal mycoplasma detection kit, by American Type Culture Collection (2 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions) Opti mem, by Thermo Fisher Scientific (2 mentions) Molt 4, by American Type Culture Collection (1 mentions) Ccrf cem, by American Type Culture Collection (1 mentions) Rpmi 8402, by American Type Culture Collection (1 mentions) Molt 13, by Leibniz Institute DSMZ (1 mentions) Sup b15, by American Type Culture Collection (1 mentions) Hpb all, by Leibniz Institute DSMZ (1 mentions) Kopn 8, by Leibniz Institute DSMZ (1 mentions) Nalm 6 cells, by Leibniz Institute DSMZ (1 mentions) Molm 14, by Leibniz Institute DSMZ (1 mentions) Jurkat, by American Type Culture Collection (1 mentions) Rch acv, by American Type Culture Collection (1 mentions)

10 protocols using rch acv

1

Establishing NSD2 Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lines, RNA-seq, ATAC-seq, and ChIP-seq methods published previously [5 ]. The B-lineage leukemia cell lines RS4;11, RCH-ACV, and SEM were used for the purposes of this study. RS4;11 was acquired from ATCC (Manassas, VA), RCH-ACV was acquired from DSMZ (Braunschweig, Germany), and SEM was kindly gifted by Jun Yang, St. Jude Children’s Hospital. Each leukemia cell line was validated by short tandem repeat analysis through ATCC except for RCH-ACV which was purchased from DSMZ directly. DSMZ routinely verifies cell lines and provides authentication information with each order. Cell lines were routinely monitored for mycoplasma contamination by PCR using ATCC Universal Mycoplasma Detection Kit (20–1012K). NSD2 Low cell lines were generated in these three B-ALL cell lines because they naturally harbor a heterozygous NSD2 EK mutation. More specifically, a short-hairpin RNA (shRNA: GGAAACTACTCTCGATTTATG) was used to knockdown NSD2 targeting the NSD2 Type II and NSD2 RE-IIBP isoforms both of which contain the SET domain.
Narang S., Evensen N.A., Saliba J., Pierro J., Loh M.L., Brown P.A., Kolekar P., Mulder H., Shao Y., Easton J., Ma X., Tsirigos A, & Carroll W.L. (2023). NSD2 E1099K drives relapse in pediatric acute lymphoblastic leukemia by disrupting 3D chromatin organization. Genome Biology, 24, 64.
+ Open protocol
+ Expand
2

Cell Culture Protocol for Leukemia Cell Lines

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RCH-ACV and Kasumi-2 cells were purchased from DSMZ (Germany). RCH-ACV+ROR1V5, SupB15, and REH cells were described previously (10 (link)). U937 cells were purchased from ATCC. All cell lines were cultured in RPMI1640 supplemented with 10% FBS, 2% L-Glutamine, 1% penicillin/streptinomycin, and 0.1% Fungizone (R10). All cells were grown at 37°C with 5% CO2.
Chow M., Gao L., MacManiman J.D., Bicocca V.T., Chang B.H., Alumkal J.J, & Tyner J.W. (2018). Maintenance and Pharmacologic Targeting of ROR1 Protein Levels via UHRF1 in t(1;19) pre-B-ALL. Oncogene, 37(38), 5221-5232.
+ Open protocol
+ Expand
3

Cell Line Authentication and Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
RCH-ACV (DSMZ, RRID:CVCL_1851), SEM (DSMZ, RRID:CVCL_ 0095), RPMI-8402 (ATCC, RRID:CVCL_1667), CCRF-CEM (ATCC, RRID:CVCL_0207), HPB-ALL (DSMZ, RRID:CVCL_1820), MOLT13 (DSMZ, RRID:CVCL_1422), 697 (DSMZ, RRID: CVCL_0079), SUP-B15 (ATCC, RRID:CVCL_0103), MOLT4 (ATCC, RRID: CVCL_0013), and HEK 293T (ATCC, RRID:CVCL_0063) cell lines were purchased in 2016 and 2017, authenticated using short tandem repeat DNA profiling in 2019, and tested regularly for Mycoplasma contamination. All cell lines were used for the experiments within five passages.
Li J., Hlavka-Zhang J., Shrimp J.H., Piper C., Dupéré-Richér D., Roth J.S., Jing D., Casellas Román H.L., Troche C., Swaroop A., Kulis M., Oyer J.A., Will C.M., Shen M., Riva A., Bennett R.L., Ferrando A.A., Hall M.D., Lock R.B, & Licht J.D. (2022). PRC2 Inhibitors Overcome Glucocorticoid Resistance Driven by NSD2 Mutation in Pediatric Acute Lymphoblastic Leukemia. Cancer discovery, 12(1).
+ Open protocol
+ Expand
4

Cell Culture and Maintenance

Check if the same lab product or an alternative is used in the 5 most similar protocols
RS4;11, KOPN-8, REH, EU-3, RCH-ACV, and NALM-6 cells were purchased (DSMZ, Germany), UoCB6 cells were kindly provided by J. Rowley (USA) and cultured (RPMI-1640 medium, 20% fetal bovine serum, 1% L-Glutamine, 1% Penicillin/Streptomycin; 5% CO2, 37 °C).
Seyfried F., Stirnweiß F.U., Niedermayer A., Enzenmüller S., Hörl R.L., Münch V., Köhrer S., Debatin K.M, & Meyer L.H. (2022). Synergistic activity of combined inhibition of anti-apoptotic molecules in B-cell precursor ALL. Leukemia, 36(4), 901-912.
+ Open protocol
+ Expand
5

Characterization of Imatinib-Resistant K562 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MOLM14, RCH-ACV, K562, and Kasumi-2 cell lines were obtained from DSMZ and maintained in RPMI medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, and 0.5% penicillin/streptomycin. Ba/F3 and 32D cells were originally purchased from American Type Culture Collection (ATCC). Ba/F3 and 32D cells overexpressing empty vector, BCR-ABL, BCR-ABLT315I or BCR-ABLkinase dead were generated as previously described and maintained in the same medium as mentioned above. [19 ,20 (link)] K562R cell lines, which display IM resistance in the absence of BCR-ABL mutations, were initially generated by culturing naïve K562 cells with FGF2 and imatinib, as described previously.[21 (link)] Resistant K562R cells were maintained in 0.5–1 μM imatinib. Multiple K562R cell lines were generated and tested for similar behavior. Sequencing of the BCR-ABL and FGFR3 genes in K562R revealed no mutations.
Bandyopadhyay S., Li J., Traer E., Tyner J.W., Zhou A., Oh S.T, & Cheng J.X. (2017). Cholesterol esterification inhibition and imatinib treatment synergistically inhibit growth of BCR-ABL mutation-independent resistant chronic myelogenous leukemia. PLoS ONE, 12(7), e0179558.
+ Open protocol
+ Expand
6

Cell Line Procurement and Maintenance

Check if the same lab product or an alternative is used in the 5 most similar protocols
NALM6, RCH-ACV, REH, KARPAS-45 were obtained from DSMZ (Braunschweig, Germany). Jurkat and K562 cells were obtained from ATCC (Manassas, VA, USA). All cell lines were maintained according to manufacturer's protocol.
Tan Y.S., Kim M., Kingsbury T.J., Civin C.I, & Cheng W.C. (2014). Regulation of RAB5C Is Important for the Growth Inhibitory Effects of MiR-509 in Human Precursor-B Acute Lymphoblastic Leukemia. PLoS ONE, 9(11), e111777.
+ Open protocol
+ Expand
7

B-lineage Leukemia Cell Lines Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The B-lineage leukemia cell lines RS4;11, Reh (ATCC, Manassas, VA), KOPN8, 697, RCH-ACV (DSMZ, Braunschweig, Germany), and SEM (kindly gifted by Jun Yang, St. Jude Children’s Hospital) were grown in RPMI1640 medium. HEK293T (ATCC) cells were grown in DMEM medium. All media were supplemented with 10% FBS, 1% penicillin/streptomycin under 5% CO2 at 37°C. No cell lines were used beyond passage 20. Each leukemia line was validated by short tandem repeat analysis through ATCC except for RCH-ACV which was purchased from DSMZ directly. DSMZ routinely verifies cell lines and provides authentication information with each order. Cell lines were routinely monitored for mycoplasma contamination by PCR using ATCC Universal Mycoplasma Detection Kit (20–1012K).
Pierro J., Saliba J., Narang S., Sethia G., Fleur-Lominy S.S., Chowdhury A., Qualls A., Fay H., Kilberg H.L., Moriyama T., Fuller T.J., Teachey D.T., Schmiegelow K., Yang J.J., Loh M.L., Brown P.A., Zhang J., Ma X., Tsirigos A., Evensen N.A, & Carroll W.L. (2020). The NSD2 p.E1099K Mutation is Enriched at Relapse and Confers Drug Resistance in a Cell Context Dependent Manner in Pediatric Acute Lymphoblastic Leukemia. Molecular cancer research : MCR, 18(8), 1153-1165.
+ Open protocol
+ Expand
8

Cell Line Culturing and Maintenance

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For full details (age and cytogenetics) please refer to Supplementary Table 2. Reh, NALM-6, RCH-ACV, RS4;11 and TOM-1 were purchased from DSMZ (cat. numbers – ACC 22, ACC 128, ACC 548, ACC 508, ACC 578). K562 were a kind gift from Prof Asim Khwaja, UCL Cancer Institute, Department of Hematology, London, UK. 293T cells were purchased from ATCC (cat. number CRL-3216). All leukemic cells were grown in RPMI 10% FBS at 37 °C and 5% CO2. 293T cells were grown in DMEM 10% FBS at 37 °C and 5% CO2. iPSC cells were maintained and differentiated as in ref. 28 (link).
Wray J.P., Deltcheva E.M., Boiers C., Richardson S.Е., Chhetri J.B., Brown J., Gagrica S., Guo Y., Illendula A., Martens J.H., Stunnenberg H.G., Bushweller J.H., Nimmo R, & Enver T. (2022). Regulome analysis in B-acute lymphoblastic leukemia exposes Core Binding Factor addiction as a therapeutic vulnerability. Nature Communications, 13, 7124.
+ Open protocol
+ Expand
9

Cell Culture Protocol for Leukemia Cell Lines

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RCH-ACV and Kasumi-2 cells were purchased from DSMZ (Germany). RCH-ACV+ROR1V5, SupB15, and REH cells were described previously (10 (link)). U937 cells were purchased from ATCC. All cell lines were cultured in RPMI1640 supplemented with 10% FBS, 2% L-Glutamine, 1% penicillin/streptinomycin, and 0.1% Fungizone (R10). All cells were grown at 37°C with 5% CO2.
Chow M., Gao L., MacManiman J.D., Bicocca V.T., Chang B.H., Alumkal J.J, & Tyner J.W. (2018). Maintenance and Pharmacologic Targeting of ROR1 Protein Levels via UHRF1 in t(1;19) pre-B-ALL. Oncogene, 37(38), 5221-5232.
+ Open protocol
+ Expand
10

Characterization of B-ALL Cell Lines

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
E2A-PBX1+ B-ALL cell lines RCH-ACV and 697, as well as E2A-PBX1- B-ALL cell lines REH and SEM were obtained from DSMZ (Braunschweig, Germany) in 2013, and were authenticated in 2020 in DSMZ. They were monitored to exclude mycoplasma contamination regularly. Culturing of human cells was performed as previously described [7 (link)]. RPMI-1640, IMDM, DMEM, and Opti-MEM mediums were obtained from Thermo Fisher (Waltham, MA, USA). Torin-1, everolimus (RAD001), ipatasertib (GDC-0068), alpelisib (BYL719), capivasertib (AZD5363) and idelalisib (CAL-101) were from Selleck Chemicals (Houston, TX, USA). FBS was from Sigma-Aldrich (St. Louis, WIS, USA).
Grüninger P.K., Uhl F., Herzog H., Gentile G., Andrade-Martinez M., Schmidt T., Han K., Morgens D.W., Bassik M.C., Cleary M.L., Gorka O., Zeiser R., Groß O, & Duque-Afonso J. (2022). Functional characterization of the PI3K/AKT/MTOR signaling pathway for targeted therapy in B-precursor acute lymphoblastic leukemia. Cancer Gene Therapy, 29(11), 1751-1760.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!