Sequence scanner 2

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Sequence Scanner 2 software is a tool designed for analyzing and visualizing DNA sequence data. It provides a user-friendly interface for reviewing sequence alignments, identifying sequence variations, and generating reports.

Automatically generated - may contain errors

Lab products found in correlation

Nucleospin gel and pcr clean up kit, by Macherey-Nagel (3 mentions) Bigdye terminator chemistry version 3, by Thermo Fisher Scientific (3 mentions) Generead size selection kit, by Qiagen (2 mentions) Ta cloning kit, by Thermo Fisher Scientific (2 mentions) Genejet gel extraction kit, by Thermo Fisher Scientific (2 mentions) 3730xl capillary sequencer, by Thermo Fisher Scientific (2 mentions) Gel pcr dna fragments extraction kit, by IBI Scientific (1 mentions) Quant it picogreen dsdna assay kit, by Thermo Fisher Scientific (1 mentions) Qiamp dna micro kit, by Qiagen (1 mentions) Geneclean spin kit, by MP Biomedicals (1 mentions) Abi prism 3130 genetic analyzer, by Thermo Fisher Scientific (1 mentions) Gfx pcr dna and gel band purification kit, by GE Healthcare (1 mentions)

12 protocols using sequence scanner 2

HPV Genotyping via Dideoxy Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were purified using the GeneRead Size Selection Kit (QIAGEN) and eluted in 100 uL of molecular biology-grade water on the QIAcube. Dideoxy sequencing of the amplicons (~200 ng DNA/sample) was performed using primer GP-E6-3 F at Eurofins Operon (USA). Sequence quality was assessed using Sequence Scanner 2.0 (appliedbiosystems.com) where a “high quality” Trace Score (TS) was defined as ≥20 and a QV20+ value (total number of bases in the sequence with TS ≥20) as ≥100. Quality sequences were entered into BLAST^® and queried against HPV sequences in GenBank^® (Taxon identifier: 151340) for genotyping as previously described [11 (link)].

Shen-Gunther J., Wang Y., Lai Z., Poage G.M., Perez L, & Huang T.H. (2017). Deep sequencing of HPV E6/E7 genes reveals loss of genotypic diversity and gain of clonal dominance in high-grade intraepithelial lesions of the cervix. BMC Genomics, 18, 231.

+ Open protocol

+ Expand

Bacterial Identification via 16S rDNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the 16S rDNA identification, the rhizobacteria were selected based on the chitinase activity, ARDRA and BOX-PCR fingerprinting using the facility at Scigenom Labs Pvt. Ltd. (Cochin, India). The raw forward and reverse sequences obtained after sequencing of the isolates were analyzed by Sequence Scanner 2.0 software (Applied Biosystems) to filter out the low-quality base calls. The low-quality base calls were trimmed from both the sequences and aligned to remove the overlap regions. Then the contigs generated were assembled and screened for chimeras using DECIPHER software [36 (link)]. The 16S rDNA sequences generated after screening were identified by EzBioCloud 16S database [38 (link)] and submitted to the GenBank. The 16S rDNA gene sequences of antagonistic bacterial isolates along with their closest homology sequences retrieved from NCBI GeneBank were aligned by using multiple sequence alignment CLUSTAL W algorithm executed in MEGA X software [33 (link)]. These aligned sequences were used to construct the phylogenetic tree using neighbour-joining (NJ) method by MEGA 6 program and evolutionary distances were computed with the help of Kimura’s 2 parameter model [22 (link)]. Bootstrap analysis with 1000 replications using p-distance model was performed to estimate the confidence of a particular clade [11 (link)].

Dutta J, & Thakur D. (2021). Diversity of culturable bacteria endowed with antifungal metabolites biosynthetic characteristics associated with tea rhizosphere soil of Assam, India. BMC Microbiology, 21, 216.

+ Open protocol

+ Expand

Phylogenetic Analysis of Genetic Sequences

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Principal component analysis (PCA) was used to analyse the morphometric data, and was implemented in MINITAB version 17
¹⁷. The quality of the DNA sequences obtained was evaluated using the software Sequence Scanner 2.0 (Applied Biosystems, USA). The sequence data obtained from this study were complemented by additional sequences downloaded from the National Center for Biotechnology Information (NCBI) and DNA Data Bank of Japan (DDJB) databases (accession numbers:
HQ561476 Mozambique;
KF489627 South Africa;
JQ350086 Madagascar;
MH331781 Saudi Arabia;
JF952781 Japan;
JN311937 Indonesia;
HM423533 Australia). The forward and reverse sequence data were combined using the software Bioedit version 7.2.6.1
¹⁸. The sequences were trimmed and aligned using the ClustalX
^{19 (link)} routine in MEGA 6
^{20 (link)}. The phylogenetic topology reconstruction was implemented in MEGA 6 with the neighbour-joining method and genetic distance was analysed using the compute within groups mean distance option.
Although PCA in this research was implemented in MINITAB, the free software

JASP

^{21 (link)} could be used as an alternative, although we could not guarantee total equivalence between the two software packages. Genetic analyses in this study were implemented using Sequence Scanner 2.0, ClustalX 2.1 and MEGA 6.

Afrisal M., Iwatsuki Y, & Burhanuddin A.I. (2021). Morphological and genetic evaluation of the thumbprint emperor, Lethrinus harak (Forsskål, 1775) in the Pacific and Indian Oceans. F1000Research, 9, 915.

+ Open protocol

+ Expand

HPV Genotyping via PCR and Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were purified using the GeneRead Size Selection Kit (Qiagen) on the QIAcube robot. Sanger sequencing of the amplicons (~200 ng DNA/sample) was performed by using sequencing primers MY11, FAP59, and GP-E6-3F (Eurofins Operon). Sequence quality was assessed using the Sequence Scanner 2.0 (appliedbiosystems.com), where a “high-quality” trace score (TS) (average base call quality value) was defined as ≥20 and a QV20+ value (total number of bases in the sequence with TS ≥ 20) as ≥100. Quality sequences were filter selected for entry into the Basic Local Alignment Search Tool (BLAST®) and queried against HPV sequences in GenBank® under virus taxonomy ID# 151340 [23 (link)]. The HPV genotype was based on the most homologous and significant result. The proportions of samples in which HPV was detected according to (1) genotype and (2) carcinogenic potential within each cytological category were compared.

Shen-Gunther J., Wang C.M., Poage G.M., Lin C.L., Perez L., Banks N.A, & Huang T.H. (2016). Molecular Pap smear: HPV genotype and DNA methylation of ADCY8, CDH8, and ZNF582 as an integrated biomarker for high-grade cervical cytology. Clinical Epigenetics, 8(1), 96.

+ Open protocol

+ Expand

Genotyping Retinal CFH Y402H Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from graded donor retinal tissue using QIAmp DNA Micro kit (Qiagen; Hilden, Germany). DNA was quantified using Quant-iT PicoGreen dsDNA assay kit (ThermoFisher; Waltham, MA, USA). Samples were genotyped for the Complement Factor H (CFH) variant Y402H using allele-specific primers designed for the single nucleotide polymorphism (SNP) rs1061170. CFH-Y402H-F: TGAGGGTTTCTTCTTGAAAATCA, CFH-Y402H-R: CCATTGGTAAAACAAGGTGACA. PCR product purified with Gel PCR DNA fragments extraction kit (IBI Scientific; Shelton, CT, USA) was submitted for classic Sanger Sequencing (U of MN Genomics Core). Base calling was manually inspected using Sequence Scanner 2 software (Applied Biosystems; Foster City, CA, USA).

Ebeling M.C., Geng Z., Kapphahn R.J., Roehrich H., Montezuma S.R., Dutton J.R, & Ferrington D.A. (2021). Impaired Mitochondrial Function in iPSC-Retinal Pigment Epithelium with the Complement Factor H Polymorphism for Age-Related Macular Degeneration. Cells, 10(4), 789.

+ Open protocol

+ Expand

Genomic DNA Sequencing for CRISPR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA isolated from callus, regenerated plants or seedlings was used for the polymerase chain reaction (PCR) using primers spanning the target sites (Table S8) or the predicted off‐target sites (Table S9). PCR products were resolved on the agarose gel and extracted using GeneJET Gel Extraction Kit (Thermo Scientific, USA) for sequencing from both ends using the forward and the reverse primers by the Sanger Sequencing method at Eurofins Genomics USA (www.eurofinsgenomics.com). Selected PCR amplicons were cloned into pCR2.1 vector using the TA cloning kit (Thermo‐Fisher Scientific, NY) as per the manufacturer's instructions. Randomly picked 15 to 20 colonies were verified for the insert by PCR using the amplicon‐specific primers and sequenced at Eurofins Genomics USA. The sequence traces (ABI files) were analyzed on the Sequence Scanner 2 software (Applied Biosystems Inc.) and aligned with the reference sequences using the CLUSTAL‐Omega multiple sequence alignment tool. The overlapping sequence traces arising from heterozygous alleles or chimeric samples were separated using the CRISP‐ID tool (Dehairs, Talebi, Cherifi, & Swinnen, 2016).

Nandy S., Pathak B., Zhao S, & Srivastava V. (2019). Heat‐shock‐inducible CRISPR/Cas9 system generates heritable mutations in rice. Plant Direct, 3(5), e00145.

+ Open protocol

+ Expand

Sanger Sequencing Validation of EPAS1 Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols

The variants detected in HRM analysis were further confirmed via checking with Sanger sequencing for identifying the mutations in EPAS1 sequence. Briefly, after HRM analysis, PCR products from mutant samples were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey- Nagel, Bethlehem, PA, USA) according to the manufacturer's protocols. Then, the purified PCR products were sequenced using Big Dye Terminator Chemistry version 3.1 (Applied Biosystems, Foster City, CA, USA) under standardized cycling PCR conditions. The generated data were analyzed at the Australian Genome Research Facility using a 3730xl Capillary sequencer (Applied Biosystems). The sequences were analyzed with Sequence Scanner 2 software (Applied Biosystems).

Islam F., Gopalan V., Law S., Lam A.K, & Pillai S. (2020). Molecular Deregulation of EPAS1 in the Pathogenesis of Esophageal Squamous Cell Carcinoma. Frontiers in Oncology, 10, 1534.

+ Open protocol

+ Expand

CRISPR-based Mutation Analysis in Plants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA isolated from callus, regenerated plants or seedlings, was used for polymerase chain reaction (PCR) using primers spanning the target sites (Table 4). The PCR products were resolved on agarose gel and extracted using Geneclean Spin Kit (MP Biomedicals, CA, USA) for sequencing from both ends using forward and reverse primers by the Sanger Sequencing method at Eurofins Genomics USA. The sequences were viewed on Sequence Scanner 2 software (Applied Biosystems Inc.) and aligned with the reference sequences using CLUSTAL-Omega multiple sequence alignment tool. CRISPR-ID tool was used to separate superimposed overlapping spectrum in Sanger sequencing traces, characteristic of heterozygous or chimeric mutations (Dehairs et al. 2016 (link)). The type of indel was identified by cloning PCR amplicon into pCR2.1 vector using TA cloning kit (Thermo-Fisher Scientific, NY) as per manufacturer’s instructions and sequencing individual colonies by Sanger sequencing.

Pathak B., Zhao S., Manoharan M, & Srivastava V. (2019). Dual-targeting by CRISPR/Cas9 leads to efficient point mutagenesis but only rare targeted deletions in the rice genome. 3 Biotech, 9(4), 158.

+ Open protocol

+ Expand

DNA Sequencing of Gene Exons

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA targets were PCR-amplified using primer pairs flanking exons 1 to 10, as previously described (Kirschner et al., 2000b (link)). Amplified products were confirmed by electrophoresis on 6.5% polyacrylamide gels with silver staining. PCR products were purified with GFX^™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Buckinghamshire, UK) and sequenced using BigDye^™ Terminator (Applied Biosytems, Foster City, CA, EUA) on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Electropherograms were manually analyzed with Sequence Scanner 2 software (Applied Biosystems, Foster City, CA, USA). The reference sequence adopted was NM_002734.4. All mutation and sequence variance found were checked at Catalogue of somatic Mutations in Cancer (COSMIC), Ensembl Genome Browser, and NCBI dbSNP databases.

Sousa S.F., Gomez R.S., Diniz M.G., Bernardes V.F., Soares F.F., Brito J.A., Liu S., Pontes H.A., Stratakis C.A, & Gomes C.C. (2015). Defects of the Carney complex's gene (PRKAR1A) in odontogenic tumors. Endocrine-related cancer, 22(3), 399-408.

+ Open protocol

+ Expand

Sanger Sequencing Protocol for Detecting Mutations

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The presence of mutations in each T0 line was determined by PCR and Sanger sequencing. Genomic DNA isolated from the T0 plants was used for the polymerase chain reaction (PCR) using primers spanning the target sites (Table S1). PCR products were resolved on the agarose gel and extracted using the GeneJET Gel Extraction Kit (Thermo Scientific, USA) for sequencing from both ends using the forward and the reverse primers by the Sanger Sequencing method (Psomagen, Rockville, MD, USA). The sequence traces (ABI files) were analyzed on the Sequence Scanner 2 software (Applied Biosystems Inc., Waltham, MA, USA) and aligned with the reference sequences using the CLUSTAL-Omega multiple sequence alignment tool. The overlapping sequences arising from heterozygous alleles were separated using the CRISP-ID or Polypeak Parser tools [43 (link),44 (link)].

Pathak B., Maurya C., Faria M.C., Alizada Z., Nandy S., Zhao S., Jamsheer K M, & Srivastava V. (2022). Targeting TOR and SnRK1 Genes in Rice with CRISPR/Cas9. Plants, 11(11), 1453.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!