Pdsred attp vector

The syp-AttP line was generated using CRISPR to delete a 4-kb section at the beginning of the Syp coding region, which was replaced by an AttP site. sgRNA construct design and validation was performed by Dr. Andrew Basset, Genome Engineering Oxford. 1-kb homology arms, corresponding to sequences flanking the sgRNA cleavage sites (located in the 5′ UTR and third intron of isoform F), were cloned into the pDsRed-attP vector (Addgene, 51019). sgRNA constructs and the homology construct were injected in vas-cas9 embryos (BL 51323) by the Cambridge Fly facility. Embryos from the syp-AttP line were then injected with an AttB construct (RIV^Cherry; Baena-Lopez et al., 2013 (link)) containing eGFP fused to the N terminus of Syp. sgRNA guide sites were as follows: 5′-TGC​GTT​CGT​TGA​ACT​CTA​CAA​GG-3′ and 5′-CCT​TTC​GAT​TTG​GGG​GGA​TAT​GG-3′.

We identified optimal target gRNA sites by relying on comparable results from two independent programs, “CRISPR Optimal Target Finder” (University of Wisconsin; http://tools.flycrispr.molbio.wisc.edu/targetFinder/index.php) and Harvard’s “Find CRISPR” sgRNA design tool (http://www.flyrnai.org/crispr/index.html)^{55 (link)}. Target sites were confirmed by sequencing corresponding loci in the Vas.Cas9 line (Bloomington #51323) that we used for embryo injections. CRISPR lines were generated via CRISPR/Cas9 homology-directed repair to replace endogenous alleles. Plasmids carrying gRNA target sites were cloned into pCFD3 (Addgene #49410) for AGBE^FCF, AGBE^FCM, IRP1A^3F and IRP1B^3F constructs, or pCFD5^{56 (link),57 (link)} (Addgene #73914) for IRP1A^KO, IRP1A^FCF and IRP1B^KO. All donor template fragments were amplified from genomic DNA via PCR and cloned into the pDsRed-attP vector (Addgene #51019)^{57 (link)}. For primers see Table 3.

To generate a CG14740 null mutant, two gRNAs targeting the CG14740 coding sequence (gRNA 1: AGTGTTAATAGCGTGATTGGAGG, and gRNA 2: CTTATATTCCAGGTCATTCCCGG) were cloned into the pCFD5 vector (Addgene: Plasmid #73914, generated by ref. ^{125 (link)}). A 1.104 kb homology arm flanking the cleavage site 1 was PCR-amplified from genomic DNA using the Q5 high-fidelity polymerase from New England Biolabs (M0491S) and the following primers: 5’-AAAAGCTAGCTGGACAAAATCAGAACGGCA-3’ and 5’-AAAACCGCGGATCACGCTATTAACACTGATC-3’. The PCR product was digested with NheI and SacII prior to cloning into the pDsRedattP vector (Addgene: Plasmid #51019, generated by^{126 (link)}). A 1.186 kb homology arm flanking the cleavage site 2 was PCR-amplified from genomic DNA using the following primers: 5’-AAAACCTAGGTCCCGGCTACGGACACGCTG-3’and 5’-AAAACTCGAGACATGGAAGTGGAAAGGGGT-3’. The PCR product was digested with AvrII and XhoI prior to cloning into the pDsRedattP vector, containing the first homology arm. The constructs were sequence-verified and a mutant line was established through injection (Bestgene) of the 2 generated vectors (pCFD5 gRNAs and pDsRedattP homology arms) in yw;nos-Cas9 (FlyBase ID: FBti0156858, generated by^{127 (link)}) embryos. The generated deletion removed 1016 nucleotides (nt) of the CG14740 coding sequence and replaced it with an attP landing site and a loxP-flanked 3xP3-DsRed marker.