Ambion turbo dna free
Ambion Turbo DNA-free is a lab equipment product designed for the removal of DNA contamination from RNA samples. It utilizes a proprietary enzymatic treatment to effectively degrade any residual DNA, ensuring the purity of the final RNA preparation.
Lab products found in correlation
18 protocols using ambion turbo dna free
RNA Extraction and cDNA Synthesis
RNA Extraction and cDNA Synthesis
Quantitative RT-PCR Gene Expression Analysis
The expression of the genes was normalized to the expression of β-actin (or to U48 where indicated); relative expression was calculated using ΔΔCt method according to the instructions of the User Bulletin #2 (Applied Biosystems).
Total RNA Isolation and cDNA Synthesis
RNA Isolation and cDNA Synthesis from B. juncea
RNA Expression Profiling of CfCYP Genes
Hippocampal Protein and RNA Extraction
RNA Extraction and qRT-PCR Analysis
iPSC-Derived Macrophage Gene Expression
Target | Forward primer (5′–3′) | Reverse primer (5′–3′) |
---|---|---|
TATABox protein | GAACCACGGCACTGATTTTC | CCCCACCATGTTCTGAATCT |
RIPK1 | TTACATGGAAAAGGCGTGATACA | AGGTCTGCGATCTTAATGTGGA |
TNFα | TGTTGTAGCAAACCCTCAAGC | TATCTCTCAGCTCCACGCCA |
IL1-β | AAAGCTTGGTGATGTCTGGTC | GGACATGGAGAACACCACTTG |
Cloning and Characterization of Chalcone Synthase Gene
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!