Total RNA was extracted from MH7A cells using TRIZOL reagent (Invitrogen). cDNA was synthesized from 1 ug of total RNA using oligo-dT18 primers and reverse transcriptase in a total volume of 21 µL (Bioneer). For standard PCR, 1 µL of the first-strand cDNA product was then used and 10 pmol of specific primers were used as a template for PCR amplification with Taq DNA polymerase (Cosmo Genetech, Seoul, Korea). PCR amplification was performed using primers specific for BAFF (forward; 5’-AAT TCA GAG GAA GAA GGT CC-3’, reverse; 5’-ATG TGA CAT CTC CAT CCA GT-3’) with 36 cycles (95°C for 40 s, 57°C for 30 s and 72°C for 60 s), TNFR1 (forward: 5’-ACC AAG TGC CAC AAA GGA AC-3’, reverse: 5’-CTG CAA TTG AAG CAC TGG AA-3’), TNFR2 (forward: 5’-GGA AAC TCA AGC CTG CAC TC-3’, reverse: 5’-TGC AAA TAT CCG TGG ATG AA-3’) with 30 cycles (95°C for 40 s, 55°C for 30 s and 72°C for 30 s), and GAPDH (forward; 5’-ACA AAC CCG ATA TGG CTG AGA TCG AGA A-3’, reverse; 5’-CTT GCT TCT CCT GTT CAA TC-3’) with 28 cycles (95°C for 30 s, 55°C for 30 s and 75°C for 35 s). PCR products were detected by agarose gel electrophoresis.
Taq dna polymerase
Manufactured by Cosmogenetech
Taq DNA polymerase is a thermostable enzyme isolated from the thermophilic bacterium Thermus aquaticus. It is a critical component in the Polymerase Chain Reaction (PCR) process, responsible for replicating DNA fragments during thermal cycling.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Reverse transcriptase, by Bioneer (2 mentions)
Superscript reverse transcriptase, by Bioneer (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcription, by Thermo Fisher Scientific (1 mentions)
6 protocols using taq dna polymerase
1
Transcriptional Analysis of BAFF, TNFR1, and TNFR2 in MH7A Cells
2
Total RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from MH7A cells using TRIzolTM reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA using oligo-dT18 primers and reverse transcriptase in a total volume of 21 μl (Bioneer, Daejeon, Korea). For standard PCR, 1 μl of the first-strand cDNA product was then used and 10 pmol of specific primers were used as a template for PCR amplification with Taq DNA polymerase (Cosmo Genetech, Seoul, Korea). PCR amplification was performed using primers specific for hBAFF (forward; 5′-AATTCAGAGGAAGAAGGTCC-3′, reverse; 5′-ATGTGACATCTCCATCCAGT-3′) with 36 cycles (95 °C for 40 s, 57 °C for 30 s and 72 °C for 60 s), hHIF-1α (forward: 5′-CTCAAAGTCGGACAGCCTCA-3′, reverse: 5′-GATTGCCCCAGCAGTCTACA-3′), hVEGF (forward: 5′-TGACAGGGAAGAGGAGGAGA-3′, reverse: 5′-TGGTTTCAATGGTGTGAGGA-3′) with 30 cycles (95 °C for 40 s, 55 °C for 30 s and 72 °C for 30 s), and hGAPDH (forward; 5′-ACAAACCCGATATGGCTGAGATCGAGAA-3′, reverse; 5′-CTTGCTTCTCCTGTTCAATC-3′) with 28 cycles (95 °C for 30 s, 55 °C for 30 s and 75 °C for 35 s). PCR products were detected by agarose gel electrophoresis.
3
Quantification of BAFF, VCAM1 and Integrin β1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from MH7A cells using Nucleozol® (BMS). cDNA was synthesized from 1ug of total RNA using oligo-dT18 primers (Macrogen, Seoul, Korea) and superscript reverse transcriptase (Bioneer, Daejeon, Korea) in a total volume of 21 uL. For standard PCR, 1 µL of the first-strand cDNA product was then used as a template for PCR amplification with Taq DNA polymerase (Cosmo Genetech, Seoul, Korea). PCR amplification was performed using 10 pmol of specific primers specific for human BAFF (forward; aat tca gag gaa ggt cc, reverse; atg tga cat ctc cat cca gt), VCAM1(forward; gga acg aac act ctt acc t, reverse; gca act gaa cac ttg act g), integrin β1 (forward; cag cag ttg gtt ttg cga tt, reverse; atg cgc tgt ttt cca aca ag) and β-actin (forward;gtc acc aac tgg gac gac at, reverse; gca cag cct gga tag caa cg) with 36 thermocycles (95 °C for 40 s, 57 °C for 30 s and 72 °C for 60 s). PCR products were detected by agarose gel electrophoresis.
4
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HeLa cells using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized from 1μg of total RNA using oligo-dT18 primers and reverse transcriptase in a total volume of 21 μl (Bioneer, Daejeon, Korea). For standard PCR, 1 μL of the first-strand cDNA product as a template and 10 pmol of specific primers were used for PCR amplification with Taq DNA polymerase (Cosmo Genetech, Seoul, Korea). PCR amplification was performed using oligonucleotides specific for target genes, HIF-1α, VEGF, VEGF-A, VEGF-B, VEGF-C, VEGF-D, and β-actin (Table 1 ). PCR products were detected by 1.2% agarose gel electrophoresis with a marker of 100 bp ladder.
5
RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested, and total RNA was isolated using TRIzol (Invitrogen). The total RNA (4 μg) was reverse transcribed in a 40 μl reaction volume using M-MLV reverse transcriptase (Invitrogen). PCR reactions were performed with TaqDNA polymerase (Cosmo Genetech) using the following primers synthesized by Bioneer: Gapdh F-primer 5′ ACCACAGTCCATGCCATCAC 3′ and R-primer 5′TCCACCACCCTGTTGCTGTA3′, Sur8 F-primer 5′TATCCAGTGGGAGGTCCATC3′ and R-primer 5′CCTCAGGAAGGTGAGTGAGC3′, Mmp-2 F-primer 5′GAGATCTGCAAACAGGACAT3′ and R-primer 5′GGTTCTCCAGCTTCAGGTAA3′, Mmp-9 F-primer 5′CGACGAGTTGTGGTCGCTGG3′ and R-primer 5′GCACGCTGGAATGATCTGAG3′. PCR products were run on a 2% agarose gel, and the bands were visualized under ultraviolet illumination.
6
RT-PCR and Primer Design for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or ground tissue powder using the TRIzol reagent (Invitrogen). RT was performed using M-MLV reverse transcription (Invitrogen). PCR reactions were performed using Taq DNA polymerase (COSMO Genetech) at 94°C for 5 min followed by 25–40 cycles of 94°C for 30 s, 55–60°C for 30 s, and 72°C for 1 min in a System 2700 thermal cycler (Applied Biosystems). The following primer sets were used: human CXXC5, forward 5′-AGCCGAGTGAAGACATTTCCACCT-3′ and reverse 5′-TAATGAAGAGGCCTGGGTTGATGG-3′; mouse CXXC5, forward 5′-CAAGAAGAAGCGGAAACGCTGC-3′ and reverse 5′-TCTCCAGAGCAGCGGAAGGCTT-3′; human GAPDH, forward 5′-AAGGTCGGAGTCAACGGATT-3′ and reverse 5′-AGTGATGGCATGGACTGTGG-3′; mouse GAPDH, forward 5′-ACCACAGTCCATGCCATCAC-3′ and reverse 5′-TCCACCACCCTGTTGCTGTA-3′; human endothelin-1, forward 5′-TTCCCACAAAGGCAACAGACCG-3′ and reverse 5′-GACAGGCCCCGAAGTCTGTCA-3′; mouse endothelin-1, forward 5′-ACTTCTGCCACCTGGACATCATCT-3′ and reverse 5′-TGGTCTGTGGCCTTATTGGGAAGT-3′; mouse c-Myc, forward 5′-TGGTGTCTGTGGAGAAGAGGCAAA-3′ and reverse 5′-TTGGCAGCTGGATAGTCCTTCCTT-3′; and mouse cyclin D1, forward 5′-TGCTGCAAATGGAACTGCTTCTGG-3′ and reverse 5′-TACCATGGAGGGTGGGTTGGAAAT-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!