Mouse Tlr4 was targeted for mutation in HEI‐OC1 cells using TrueCutTM Cas9 Protein V2 (Invitrogen, A36498), TrueGuideTM tracrRNA (Invitrogen, A35507), and TrueGuideTM Syn crRNA (Invitrogen, A35509‐CRISPR511653) and gRNA (Target: GATTCAAGCTTCCTGGTGTC). TrueGuide™ Syn crRNA, Negative Control, (Invitrogen, A35519) was used as a non‐targeting crRNA in this assay. Gene editing efficiency was verified using the GeneArtTM. Genomic Cleavage Detection kit (Invitrogen, A24372) in a pooled cell population. Procedures were carried out based on the manufacturer’s protocols. Single‐cell clones were then isolated for further validation using limited dilution in 96‐well plates. Tlr4 deletion clones were then screened for loss of LPS‐induced IL‐6 cytokine secretion. Genomic DNA from selected clones was amplified at the Tlr4 locus and analyzed by Sanger Sequencing using primer pair: 5′‐CCTCCAGTCGGTCAGCAAAC‐3′ and 5′‐CTAAGCAGAGCACACACAGGG‐3′.
Trueguide tracrrna
Manufactured by Thermo Fisher Scientific
The TrueGuideTM tracrRNA is a synthetic RNA molecule designed to facilitate the CRISPR-Cas9 gene editing system. It serves as a crucial component in the guide RNA complex, guiding the Cas9 endonuclease to the target DNA sequence for precise genome modifications.
Automatically generated - may contain errors
2 protocols using trueguide tracrrna
1
CRISPR-Mediated Tlr4 Knockout in HEI-OC1 Cells
2
CRISPR-Mediated Tlr4 Knockout in HEI-OC1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse Tlr4 was targeted for mutation in HEI-OC1 cells using TrueCut TM Cas9 Protein V2 (Invitrogen, A36498), TrueGuide TM tracrRNA (Invitrogen, A35507) and TrueGuide TM Syn crRNA (Invitrogen, A35509-CRISPR511653) and gRNA (Target: GATTCAAGCTTCCTGGTGTC). TrueGuide™ Syn crRNA, Negative Control, (Invitrogen, A35519) was used as a non-targeting crRNA in this assay. Gene editing efficiency was verified using the GeneArt TM Genomic Cleavage Detection kit (Invitrogen, A24372) in a pooled cell population. Procedures were carried out based on the manufacturer's protocols. Single-cell clones were then isolated for further validation using limited dilution in 96-well plates. Tlr4 deletion clones were then screened for loss of LPS-induced IL-6 cytokine secretion. Genomic DNA from selected clones was amplified at the Tlr4 locus and analyzed by Sanger Sequencing using primer pair: 5'-CCTCCAGTCGGTCAGCAAAC-3' and 5-'CTAAGCAGAGCACACACAGGG-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!