Pcr amplifier

Tissues from 21 HCC patients who underwent surgical resection in Zhongshan Hospital were collected. Total RNA from tissues were extracted using the relevant purification kit (EZB, Suzhou, China). Reverse transcription and quantitative real-time PCR were conducted referring to the kit or the SYBR green mix (EZB, Suzhou, China) and the instructions of the PCR amplifier (Bio-Rad, CA, USA). The following primers were used for the genes indicated: β-actin, forward primer: GACTACCTCATGAAGATCCTCACC and reverse primer: TCTCCTTAATGTCACGCACGATT; PVR, forward primer: TGGAGGTGACGCATGTGTC and reverse primer: GTTTGGACTCCGAATAGCTGG. For immunohistochemistry, formalin-fixed paraffin-embedded sections (5 μm) were deparaffinized with xylene, rehydrated with a graduated series of ethanol, and rinsed with distilled water. After goat serum block, sections were stained with primary antibodies against PVR (ab267788, Abcam, Cambridge, UK) overnight, followed by incubation with the horseradish peroxidase-conjugated secondary antibody for 30 min at room temperature. Then, the sections were counterstained with hematoxylin.

Cells that underwent the indicated treatments were harvested for RNA isolation using the Trizol reagent (Invitrogen, USA) according to manufacturer's instructions, and the RNA concentration was measured using a UV spectrophotometer. One microgram of total RNA was used as template for reverse transcription in accordance with the instructions of the M-MLV assay kit (Invitrogen). The primer sequences used in this study are shown in Table S1. PCR reactions (10 μl) were performed in a Bio-Rad PCR amplifier. The real-time PCR reaction system included 5 μl of SYBR Premix Ex Taq (Thermo Fisher, USA), 0.5 μl of forward primer (10 pmol/μl), 0.5 μl of reverse primer (10 pmol/μl), 1 μl of cDNA template (500 ng/μl), and 3 μl of ultrapure H₂O.
The amplification conditions comprised 40 cycles at 95 °C for 5 s and 65 °C for 30 s. The results were analyzed by the Bio-Rad CFX Manager software.

Total cellular RNA was isolated from cultured cells using Trizol reagent (Invitrogen) and reverse transcribed into cDNA using the M‐MLV assay kit (Invitrogen) according to the manufacturer's instructions. These cDNA samples were subjected to qPCR amplification of different genes with their primer sequences (Table S1) in 10 µL of the qPCR mixture in a Bio‐Rad PCR amplifier (Hercules, CA). The qPCR mixture included 5 μL SYBR Premix Ex Taq (Vazyme, Nanjing, China), 0.5 μL of each primer (10 pmol/μL), 1 μL cDNA template and 3 μL ddH₂O. Amplification conditions were initially set at 95°C for 5 minutes and then 40 cycles of 95°C for 5 seconds and 65°C for 30 seconds. The results were analysed using the Applied Biosystems QuantStudio 7 Flex software using 2^−(Ct‐Cc) (Ct and Cc were the mean threshold cycle differences after normalizing to β‐actin).

The equipment and reagents used in this study included: High Resolution Mass Spectrometer (QE Plus, Thermo Fisher Technologies, Waltham, MA, United States), PCR Amplifier (580BR10905, Bio-Rad, Hercules, CA, United States), Bioanalyzer (2100, Aglient, Santa Clara, CA, United States), NanoDrop (2000, Thermo Fisher, Waltham, MA, United States). High performance liquid chromatography (Dionex U3000 UHPLC, Thermo Fisher Technologies, Waltham, MA, United States). A chromatographic column, (100 mm × 2.1 mm, 1.8 μm), was purchased from Waters (ACQUITY UPLC HSS T3, Milford, MA, United States). A DNeasy PowerSoil Kit (Cat. No. 12888) and QIAamp 96 PowerFecal QIAcube HT kit (Cat. No. 51531) was purchased from QIAGEN (Germantown, MD, United States). Qubit dsDNA Assay Kit (Cat. No. Q32854) was purchased from Life Technologies (Eugene, OR, United States). A Tks Gflex DNA Polymerase (Cat. No. R0608) was purchased from Takara (Dalian, China). All chemicals and solvents were analytical or HPLC-grade. Water, methanol, acetonitrile, and formic acid were purchased from CNW Technologies GmbH (Düsseldorf, Germany). L-2-chlorophenylalanine was purchased from Shanghai Hengchuang Biotechnology Co., Ltd. (Shanghai, China).

Briefly, a mixture of mRNA (50 ng/μl) and sgRNA (30 ng/μl) was co-injected into the cytoplasm of pronuclear-stage zygotes. Each group was injected with an average of approximately 20 zygotes to test the base editing efficiency. The injected zygotes were transferred to potassium simplex optimized medium (KSOM) for culture at 37 °C, 5% CO₂, and 100% humidity. Then, the injected single zygote was collected at the blastocyst stage. Genomic DNA was extracted in embryo lysis buffer 1% NP40 (Meilun Biotechnology Co., Ltd) at 56 °C for 60 min and then at 95 °C for 10 min in a Bio-Rad PCR Amplifier. Then, the extracted products were amplified by PCR (95 °C, 5 min for pre-degeneration, 42 cycles of [95 °C, 30 s; 58 °C, 30 s; 72 °C, 30 s] 72 °C, 5 min for extension) and determined by Sanger sequencing. All primers used for genotyping are listed in Additional file 1: Table S5.

Briefly, a mixture of mRNA (50 ng/µl) and sgRNA (30 ng/µl) was co-injected into the cytoplasm of pronuclear-stage zygotes. Each group was injected with an average of approximately 20 zygotes to test the base editing efficiency. The injected zygotes were transferred to KSOM medium for culture at 37 °C, 5% CO₂, and 100% humidity. Then, the injected single zygote was collected at the blastocyst stage. Genomic DNA was extracted in embryo lysis buffer (1% NP40) at 56 °C for 60 minutes and then at 95 °C for 10 minutes in a Bio-Rad PCR Amplifier. Then, the extracted products were amplified by PCR (95 °C, 5 min for predegeneration, 42 cycles of (95 °C, 30 s, 58 °C, 30 s, 72 °C, 30 s), 72 °C, 5 min for extension) and determined by Sanger sequencing. The genomic DNA of newborn mice was extracted from ear clips and analyzed by PCR genotyping. All target sites and primers used for genotyping are listed in Tables S2 and S3.