Mir 567 mimic

MiR-567 mimics and oligonucleotide scramble were obtained from the GenePharm (Shanghai, China). The pcDNA3.1-FGF5 plasmid and control vector were purchased from Amspring (Changsha, China). For miR-567 overexpression, MiR-567 mimics were transfected into MG-63 and U2OS cells, while oligonucleotide scramble were used as a negative control. For restoration of FGF5 expression, pcDNA3.1-FGF5 plasmid was used to transfect the miR-567-overexpressing MG-63 and U2OS cells, while control vector was used as control. All cell transfection was performed using Lipofectamine 2000 (Invitrogen, CA, USA) according to the manufacturer's instruction. After 48 h of transfection, cells were used for the following in vitro experiments.

The hsa_circ_0030998‐overexpressing plasmid and the corresponding vector were successfully constructed by Nanjing Dehengwen Biological Technology Co., Ltd. (Nanjing, China). The sequences of circ_0030998 siRNAs were designed, and the target sequences were circ_0030998 siRNA1: 5’‐AGCTCCAAAGAACATGACCTT‐3’; and circ_0030998 siRNA2: 5’‐GAGCTCCAAAGAACATGACCT‐3’. circ_0030998 siRNAs, MMP1 siRNAs, MMP17 siRNAs, negative control (NC), miR‐1236 mimics, miR‐556‐5p mimics, miR‐558 mimics, miR‐567 mimics, miR‐574‐5p mimics, miR‐515‐5p mimics, miR‐615‐5p mimics, and miR‐NC were synthesized by GenePharma (Shanghai, China). A549 and H1299 cells were evenly seeded into 6‐well plates at a density of 1 × 10⁵ cells/well. After incubation for 8 h, cells were transfected with the specified plasmids, miRNA mimics, and siRNAs by applying Lipofectamine 3000 Reagent (Invitrogen, Waltham, MA, USA) in line with the experimental instructions. The detailed cell phenotype assays, including CCK‐8, colony formation, EdU staining, wound healing, and Transwell assays, are described in the Supporting Information.