Total mRNA was extracted using the TRIzol reagent (Invitrogen, cat. # 15596018) and purified using an EZ-10 DNAaway RNA Mini-Preps Kit (Bio Basic, cat. #BS88136-250). Complementary DNA (cDNA) was synthesized from total RNA using RevertAid Reverse Transcriptase (Thermo Fisher, Waltham, MA, cat. # 01327685) according to the manufacturer’s protocol. Real-time PCR was performed using Luna SYBR Green (New England Biolabs, UK) according to the manufacturer’s protocol using a CFX-96 Real-time PCR system (Bio-Rad, Hercules, CA, USA). A 100 ng of cDNA and 0.25 µM of the paired primer mix for target genes were used for each reaction. Relative mRNA was normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh) or a geometric mean of Ct values from beta-actin (Actb) and ubiquitin (Ubc) housekeeping genes, as calculated by BestKeeper (Pfaffl et al., 2004 (link)) and log2 fold changes were plotted with reference to the uninfected, unwounded skin. The primer pairs used in this study are listed as follow:
Ez 10 dnaaway rna mini preps kit
Manufactured by Bio Basic
Sourced in Canada
The EZ-10 DNAaway RNA Mini-Preps Kit is a laboratory tool designed for the rapid and efficient extraction of RNA from a variety of biological samples. The kit utilizes a simple and straightforward protocol to isolate high-quality RNA for downstream applications such as reverse transcription, qRT-PCR, and other molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Qscript cdna synthesis kit, by Quantabio (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Tapestation 4200, by Agilent Technologies (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Primer premier 5, by Premier Biosoft (1 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
On targetplus non targeting pool, by Horizon Discovery (1 mentions)
7 protocols using ez 10 dnaaway rna mini preps kit
1
Quantitative PCR for Gene Expression
2
RNA-seq of M. genitalium and M. pneumoniae infected HeLa cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells (1.5x106 cells/well) in each well of 6-well culture plate were infected with M. genitalium G37 or M. pneumoniae at an MOI of 1:10 (1 cell: 10 bacteria) or uninfected (control cells) and incubated for 4 h at 37°C in a CO2 incubator. This MOI and incubation time were based on our preliminary microscopic analysis. At this condition, only minimal or no necrosis/cell death of Mg or Mp infected HeLa cells was observed; hence we thought this condition was ideal for comparing the gene expression altered by these species. After the incubation, the cells were collected, washed with PBS, and RNA isolated using EZ-10 DNAaway RNA Mini-Preps Kit (Bio Basic, Toronto, Canada). Agilent Technologies 4200 TapeStation was used to analyze RNA integrity of the preparation, and RNA quantification was done using Nanodrop. 4ug of total RNA with >9 RIN (RNA Integrity Number) was used for RNA-seq library preparation.
3
Quantification of pgsB Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strains grown in batch fermentation for 20 h were harvested by centrifugation, and RNA extraction and reverse transcriptase reaction were performed using the EZ‐10 DNAaway RNA Mini Preps Kit (B618133; Bio Basic Inc., Markham, ON, Canada) and the Revert Aid First Strand cDNA Synthesis Kit (K1621; Thermo Scientific, Waltham, MA, USA) respectively. RT‐PCR was performed using 2× SG Fast qPCR Master Mix kit (B639271, SYBR Green; Bio Basic Inc., Markham, ON, Canada) on Roche Light Cycle 480 to analyses pgsB (GeneBank: KP178960 , the target gene) and 16s rDNA (GeneBank: JN815234 , the reference gene). The primers were designed by the Primer Premier 5.0 software (PREMIER Biosoft, Palo Alto, CA, USA): forward 5′‐GAGCGAGCCTGGGCACTT‐3′ and reverse 5′‐CGGTCATCGGTCGGGTAAC‐3′ (pgsB); forward 5′‐TGCCGCAATGGA CGAAAG‐3′ and reverse 5′‐TGTAAGGTGCCGCCCTATTC‐3′ (16s rDNA). Relative gene quantification was performed using the comparative 2−ΔΔCT method and normalized to 16s rDNA (Livak and Schmittgen, 2001 ).
4
Liver RNA Isolation and Quality Control
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from the liver was isolated using EZ-10 DNAaway RNA Mini-Preps Kit (Bio
Basic, Markham, Canada) according to the manufacturer’s protocol. Briefly,
frozen liver samples were homogenized and lysed in the provided lysis buffer.
Prevention of contamination by genomic DNA was achieved using the provided gDNA
eliminator column. RNA purity was determined using Nanodrop ND-1000 (Thermo
Fisher Scientific, Waltham, USA), whereas the RNA integrity was assessed via
agarose gel electrophoresis and the Agilent 2100 Bioanalyzer (Agilent).
Enrichment of samples with high-quality RNA should demonstrate an OD260/OD280
ratio of 1.9 to 2.0 from Nanodrop readings, 2 distinct bands indicating 28S and
18S following agarose gel electrophoresis, and ≥6.8 RNA integrity number with a
smooth baseline using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara,
USA).
Basic, Markham, Canada) according to the manufacturer’s protocol. Briefly,
frozen liver samples were homogenized and lysed in the provided lysis buffer.
Prevention of contamination by genomic DNA was achieved using the provided gDNA
eliminator column. RNA purity was determined using Nanodrop ND-1000 (Thermo
Fisher Scientific, Waltham, USA), whereas the RNA integrity was assessed via
agarose gel electrophoresis and the Agilent 2100 Bioanalyzer (Agilent).
Enrichment of samples with high-quality RNA should demonstrate an OD260/OD280
ratio of 1.9 to 2.0 from Nanodrop readings, 2 distinct bands indicating 28S and
18S following agarose gel electrophoresis, and ≥6.8 RNA integrity number with a
smooth baseline using the Agilent 2100 Bioanalyzer (Agilent, Santa Clara,
USA).
5
Cholangiocyte Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary cholangiocytes or SBECs (3 × 10 5 cells in 2 ml per well in 6 well plates) were plated at 37 °C to allow cell adhesion. Cells were treated with either biliatresone/DMSO for 6 h or biliatresone for 6 h followed by a 24 h washout. Total RNA from the cells was extracted with the EZ-10 DNAaway RNA Mini-Preps Kit (Bio Basic, catalog # BS88133) according to the manufacturer's protocol. cDNA was prepared using a qScript TM cDNA Synthesis kit (Quantabio, Beverly, MA). Primer sets for:
RhoU (TGTCTGTAGATGGGCGGCCTGT, TTCTGGAAGGATGTGGGGCTCA), Nf2 (ATAAAAAGGGCACAGAGTTG, AATAGTAAACTCCTTGTCGC), Amotl1 (AAAGTTGGAAATGGAGTTGG, CTTCTCTCGTAACTCTTCCTC), Wnt11 (CCAATAAACTGATGCGTCTAC, ATTTACACTTCGTTTCCAGG), Pard6G (CTGTGAATGATGAAGTCCTG, GTTGGCTATCATCATGTCTG) and Rp13a (AGGGGCAGGTTCTGGTATTG, TGTTGATGCCTTCACAGCGT) were used. Rp13a was our endogenous control. Real-time quantitative PCR was performed using the StepOnePlus real-time PCR system. Expression analysis was done using the double delta ct method as previously described 14 .
RhoU (TGTCTGTAGATGGGCGGCCTGT, TTCTGGAAGGATGTGGGGCTCA), Nf2 (ATAAAAAGGGCACAGAGTTG, AATAGTAAACTCCTTGTCGC), Amotl1 (AAAGTTGGAAATGGAGTTGG, CTTCTCTCGTAACTCTTCCTC), Wnt11 (CCAATAAACTGATGCGTCTAC, ATTTACACTTCGTTTCCAGG), Pard6G (CTGTGAATGATGAAGTCCTG, GTTGGCTATCATCATGTCTG) and Rp13a (AGGGGCAGGTTCTGGTATTG, TGTTGATGCCTTCACAGCGT) were used. Rp13a was our endogenous control. Real-time quantitative PCR was performed using the StepOnePlus real-time PCR system. Expression analysis was done using the double delta ct method as previously described 14 .
6
Quantifying Claudin-4 Expression in mIMCD3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was isolated from Cldn-4 KD/kAE1 mIMCD3 cells incubated with doxycycline for 48 hours or kept in control conditions, using EZ-10 DNAaway RNA Mini-Preps Kit, (BIOBasic Canada Inc, ON, Canada). DNAse I treatment was next performed, followed by reverse transcription of 5 µg RNA using SuperScript II transcriptase and random primers obtained from IDT (Integrated DNA Technologies, San Diego, CA). The cDNA was next used to determine claudin-4 and the internal control actin mRNA levels using primers from Thermo Fisher/ABI (claudin-4 primers and probe: Cat # Mm00515514-s1; actin primers and probe: Cat # Mm01205647-g1). Expression levels were determined by qPCR on an ABI Prism 7900 HT sequence detection System (Applied Biosystem, Foster City, CA).
7
Biliatresone and RhoU/Wrch1 Regulation in SBECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SBECs (3*105 cells in 2 ml per well in six well plates) were plated overnight at 37 °C to allow cell adhesion. On the following day, cells were treated with biliatresone, BSO, or DMSO for 24 h. For overexpression experiments, cells were transfected with RhoU/Wrch1, Hey2 plasmids, or empty plasmid. For silencing experiments, cells were treated with RhoU/Wrch1 small interfering RNA (ON-TARGET plus Mouse RhoU/Wrch1 siRNA (Dharmacon, LQ-064428-01-0002 NM_133955) or scrambled siRNA (ON-TARGETplus Non-targeting Pool, Dharmacon, D-001810-10-05), as per manufacturer’s instructions for 48 h. Total RNA from SBECs was extracted with the EZ-10 DNAaway RNA Mini-Preps Kit (Bio Basic) according to the manufacturer’s protocol. cDNA was prepared using a qScript cDNA Synthesis kit (Quantabio). Probe sets including RhoU/Wrch1 (Mm00505976_m1), Hey2 (Mm01180513_m1), Sox17 (Mm00488363_m1) and GAPDH endogenous control (Mm99999915_g1), were TaqMan pre-developed assay reagents from ABI. Real-time quantitative PCR was performed using the StepOnePlus Real-time PCR system.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!