Poly mono adp ribose

Manufactured by Cell Signaling Technology

Sourced in United States

Poly/mono-ADP ribose is a lab equipment product that functions as a substrate for the enzymatic addition or removal of ADP-ribose moieties to or from target proteins. It serves as a tool for the study of ADP-ribosylation, a post-translational modification with diverse cellular functions.

Automatically generated - may contain errors

Lab products found in correlation

Parp1, by Cell Signaling Technology (2 mentions) Flag tag (flag), by Merck Group (2 mentions) Rucaparib, by Selleck Chemicals (1 mentions) Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions) Non targeting sirna pool, by Horizon Discovery (1 mentions) Kribb11, by Selleck Chemicals (1 mentions) I3mt 3, by MedChemExpress (1 mentions) β actin, by Santa Cruz Biotechnology (1 mentions) Pei max, by Polysciences (1 mentions) Ab179515, by Abcam (1 mentions) Ab219800, by Abcam (1 mentions) Ab214185, by Abcam (1 mentions) Ab9722, by Cell Signaling Technology (1 mentions) Bcl2 associated x (bax), by Beyotime (1 mentions) Bcl 2, by Beyotime (1 mentions) Caspase 3, by Cell Signaling Technology (1 mentions) Caspase 8, by Beyotime (1 mentions) Il 1β, by Abcam (1 mentions) Ecl detection kit, by Merck Group (1 mentions) Caspase 7, by Cell Signaling Technology (1 mentions)

Spelling variants of this product

Anti-poly/mono-ADP-ribose (4 citations) Poly/Mono-ADP Ribose (E6F6A) (3 citations) Poly/Mono ADP Ribose Rabbit mAb (2 citations)

5 protocols using poly mono adp ribose

Protein Regulation and Stress Response

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All reagents were obtained from commercial sources; CTX, sodium tetrasulfide (Na₂S₄), N-acetylcysteine, 2′,7′-dichlorodihydrofluorescein diacetate (WAKO), rucaparib, KRIBB11 (Selleck), I3MT-3 (MedChemExpress), PAG (Sigma-Aldrich). The antibodies used were against FLAG (Sigma), p62 (MBL), AIF, K48-linked ubiquitin, poly/mono-ADP Ribose (Cell Signaling Technology), β-actin, PARP-1, Lamin A/C, HSP70, HSF1 (Santa cruz). Complementary DNAs (cDNAs) encoding human HSP90AB1 was obtained by performing PCR and was inserted into pcDNA3 with FLAG tag plasmid as described previously (49 (link)). Plasmid transfection was performed using PEI “Max” (Polysciences), according to the manufacturer’s instructions. siRNA targeting human HSP70 was obtained from GeneDesign (50 (link)). HT1080 cells were transfected with 10 nM nontargeting siRNA pool (Dharmacon) as control or HSP70 siRNAs using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen), according to the manufacturer’s instructions. HSP70 siRNA sequences were 5′- CACGGCAAGGUGGAGAUCA′ (HSP70 #1) and 5′- UGCACCUUGGGCUUGUCUCCGUCGU′ (HSP70 #2).

Yamada Y., Noguchi T., Suzuki M., Yamada M., Hirata Y, & Matsuzawa A. (2023). Reactive sulfur species disaggregate the SQSTM1/p62-based aggresome-like induced structures via the HSP70 induction and prevent parthanatos. The Journal of Biological Chemistry, 299(6), 104710.

+ Open protocol

+ Expand

Western Blot Analysis of Cardiac Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The heart tissue and H9C2 cells were ground and lysed by protein lysis buffer (Beyotime, China) with PMSF and phosphatase inhibitor cocktail. Total protein samples were extracted from the lysate, and the protein concentration was detected. The sample was loaded into 8% or 12% SDS-PAGE gel for electrophoresis and then transferred to the PVDF membrane. It was blocked for 1 hour and then immersed in primary antibody for 12 hours at 4°C, such as GAPDH (Proteintech, 60004-1-Ig, USA), GSDMD (Abcam, ab219800, ab209845, UK), NLRP3 (Abcam, ab214185, UK), caspase-1 (Abcam, ab179515, UK), IL-1β (Abcam, ab9722, UK), caspase-3 (Cell Signaling Technology, 14220T, USA), caspase-7 (Cell Signaling Technology, 12827T), caspase-8 (Beyotime, AC056, China), Bcl-2 (Beyotime, AB112, China), Bax (Beyotime, AB026, China), PARP-1 (Cell Signaling Technology, 9532S, USA), and poly/mono-ADP ribose (Cell Signaling Technology, 83732S, USA). The membranes were washed with TBST twice, immersed in the secondary antibody for 1 hour, and then washed again. Bands were displayed by the ECL detection kit (Millipore, USA).

Zhang Z.H., Zhang Z.G., Chen M.W., Yang Y., Li R.J., Xu J.J., Yang C., Li Y.Y., Chen H.W., Liu S.X., Li Y.L., Luo P., Liu Y.J., Chen W.B., Shan Z.G, & Huang Z.R. (2022). Inhibition of GSDMD Activates Poly(ADP-ribosyl)ation and Promotes Myocardial Ischemia-Reperfusion Injury. Oxidative Medicine and Cellular Longevity, 2022, 1115749.

+ Open protocol

+ Expand

Quantifying PAR Induction by PARPi and H2O2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded into 384-well plates (Greiner, Austria; 781090) using a Multidrop Combi (Thermo Fisher Scientific) and incubated overnight at 37°C and 5% CO₂ in a rotating incubator. PARPi compounds were added with Echo555 (LabCyte), with final compound concentration range between 1.6 pmol/L and 30 μmol/L. After 1 hour incubation with PARPi, H₂O₂ was added at final concentration of 10 mmol/L and incubated for 5 min in culture conditions. Cells were then fixed in ice-cold methanol for 15 minutes at 4°C and processed for immunostaining with primary antibody Poly/Mono-ADP Ribose (Cell Signaling Technology, #83732) followed by secondary goat anti-rabbit AlexaFluor-488 antibody (Invitrogen, #A-11008); nuclei were counterstained with DAPI. The nuclear PAR fluorescence intensity (F.I.) was acquired and analyzed using CellInsight CX5 HCS Platform (Thermo Fisher Scientific); dose–response curves were generated with GraphPad Prism software.

Illuzzi G., Staniszewska A.D., Gill S.J., Pike A., McWilliams L., Critchlow S.E., Cronin A., Fawell S., Hawthorne G., Jamal K., Johannes J., Leonard E., Macdonald R., Maglennon G., Nikkilä J., O'Connor M.J., Smith A., Southgate H., Wilson J., Yates J., Cosulich S, & Leo E. (2022). Preclinical Characterization of AZD5305, A Next-Generation, Highly Selective PARP1 Inhibitor and Trapper. Clinical Cancer Research, 28(21), 4724-4736.

+ Open protocol

+ Expand

Comprehensive Immunoblotting Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunoblotting, proteins were resolved on SDS-PAGE and analyzed using the LI-COR Odyssey Imager (LI-COR). The following primary antibodies were used (Appendix Table S3): ATG3 (A3231), MAP1LC3A (LC3, L8918), TUBA4A (alpha-Tubulin, T5168) from Sigma-Aldrich; ACTB (beta-Actin, 3700), SQSTM1 (p62, 5114), ATG7 (8858), Acetylated-Lysine (9441), FOXO1 (2880), GAPDH (2118), RELA S536 (NF-κB p65 S536, 3036), RELA (NF-κB p65, 6956), MTOR (2971), MTOR S2448 (4517), AMPKα T172 (2531), AMPKα (2793), P70S6K T389 (9206), P70S6K (2708), ULK1 (8054), Sirtuin antibody sampler kit (9787), SIRT4 (69786), PARP1 (9532), GFP (55494), Poly/Mono-ADP Ribose (83732), and PRKN (Parkin, 4211) from Cell Signaling Technology; Ac-FKHR (D-19, sc-49437), PPARGC1A (PGC1α, H-300, sc-13067), GAPDH (SC-32233), SIRT1 (B-10, sc-74504), and TOMM20 (TOM20, sc-17764) antibodies from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Dallas, TX); CD38 (60006-1-lg), BST1 (CD157, 16337-1-AP), NMNAT1 (11399-1-AP), NMNAT3 (13261-1-AP), PARP2 (2055-1-AP), and NNMT antibody (15123-1-AP) and PINK1 antibody (23274-1-AP) from Proteintech (Rosemont, IL); NMNAT2 (PA5-115662) from Invitrogen (ThermoFisher Scientific); SDHA (ab14715) antibody from Abcam.

Zhang Q., Li Z., Li Q., Trammell S.A., Schmidt M.S., Pires K.M., Cai J., Zhang Y., Kenny H., Boudina S., Brenner C, & Abel E.D. (2024). Control of NAD+ homeostasis by autophagic flux modulates mitochondrial and cardiac function. The EMBO Journal, 43(3), 362-390.

+ Open protocol

+ Expand

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were purchased from Sigma unless otherwise noted. Cells were lysed in RIPA buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 1% NP-40, 10% glycerol, 1 mM EDTA, 1 mM EGTA, 5 mM NaPPi, 50 mM NaF, 10 mM Na β-glycerophosphate) plus fresh HALT protease inhibitor cocktail (Pierce) and 1 mM Na₃VO₄ (New England Biolabs). Frozen tumor fragments were thawed, homogenized, and lysed in the same solution. Cell/tumor lysates were sonicated at 30% power for 15 s, centrifuged at 17,000 x g for 10 min at 4°C, and protein content in supernatant was quantified by BCA Assay (Pierce). Protein extracts were reduced and denatured in LDS sample buffer (GenScript) plus 1.25% β-mercaptoethanol. Proteins were separated by SDS-PAGE, transferred to nitrocellulose, and stained with Ponceau S to visually confirm protein loading and transfer. Blots were probed with primary antibodies against ER (Santa Cruz Biotechnology; cat.# sc-8002), vinculin (Cell Signaling Technology; cat.# 13901), PR (Cell Signaling Technology; cat.#8757), poly/mono-ADP ribose (Cell Signaling Technology; cat.#83732), Rb (Cell Signaling Technology; cat.#9309), phospho-Rb_S780 (Cell Signaling Technology; cat.#9307), and FLAG (Millipore Sigma; cat.# F3165). Signal was detected with DyLight conjugated secondary antibodies (Cell Signaling Technology) using the LI-COR Odyssey system (LI-COR Biosciences).

Cooper H., Smaje C, & Arber S. (1998). Use of health services by children and young people according to ethnicity and social class: secondary analysis of a national survey. BMJ : British Medical Journal, 317(7165), 1047-1051.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!