Quantstudio 7 flex fstepone plus cycler

Cecal tissue sections were snap-frozen in RNAlater solution (Thermo Fisher Scientific) after extensive washing of the content in PBS and stored in -80°C until further analysis. Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and converted to cDNAs employing RT² HT First Strand cDNA Kit (Qiagen). qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) and Ct values were recorded by QuantStudio 7 Flex FStepOne Plus Cycler. Primers were designed using the NCBI primer-designing tool (see Table 1) or ordered as validated primers from Qiagen. The mRNA expression levels were plotted as relative gene expression to β-actin (2^-ΔCt)) and comparisons are specified in the figure captions.

Cecal content was removed from cecal tissue samples, these were flash frozen in RNAlater (Invitrogen) and stored at −80 °C until further processed. RNA was isolated using RNeasy Mini Kit (Qiagen) and reverse transcribed employing RT² HT First Strand cDNA Kit (Qiagen). qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) on a QuantStudio 7 Flex FStepOne Plus Cycler. Primers were purchased as validated primer assays from Qiagen, except for those primer pairs detecting Caspase-3, Caspase-8, Lgr5, and Acl2 transcripts (listed in Table 1).Table 1

Custom-designed primers used in this study.

Gene	Forward primer sequence	Reverse primer sequence
Mouse Caspase-3	TGACTGGAAAGCCGAAACTC	AGCCTCCACCGGTATCTTCT
Mouse Caspase-8	ATGGCTACGGTGAAGAACTGCG	TAGTTCACGCCAGTCAGGATGC
Mouse Lgr5	ACCCGCCAGTCTCCTACATC	GCATCTAGGCGCAGGGATTG
Mouse Ascl2	GAGAGCTAAGCCCGATGGAG	CCAGGGATGCAGCTTAGGG

Cecal tissue sections were snap-frozen in RNAlater solution (Thermo Fisher Scientific) after extensive washing of the content in PBS and stored at −80°C until downstream analysis. Total RNA was extracted using RNeasy Mini Kit (Qiagen) and converted to cDNAs employing RT² HT First Strand cDNA Kit (Qiagen). qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) and Ct values were recorded by QuantStudio 7 Flex FStepOne Plus Cycler. Primers used either were from Qiagen as pre-validated primer assays for Cxcl9, il1a, Ccl2, Adgre1 (F4/80), or designed using the NCBI primer-designing tool (see Table 2). The mRNA expression levels were plotted as relative gene expression (2^-ΔΔCt)) and comparisons are specified in the figure caption.