Log In Sign up
The largest database of trusted experimental protocols

High pure mrna isolation kit

Manufactured by Roche
Visit Supplier

The High Pure mRNA Isolation Kit is a laboratory equipment designed to isolate and purify messenger RNA (mRNA) from various sample types, including cells, tissues, and body fluids. The kit utilizes a silica-based membrane technology to capture and wash mRNA, allowing for the efficient extraction of high-quality mRNA for downstream applications such as gene expression analysis, reverse transcription, and other molecular biology techniques.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

High Pure Isolation Kit MRNA Isolation Kit

2 protocols using high pure mrna isolation kit

1

Quantifying Interferon and Cytokine Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA was isolated using High Pure mRNA isolation kit (Roche) according to manufacturer’s instructions. qPCR was performed on extracted mRNA using Taqman primers Ifnb1 (Mm00439552), Ifna4 (Mm00833969), Tnfa (Mn00443258_m1), FlaA (FlaA Fwd GTTCAATCTTGCAACGTATGCGTC, FlaA Rev CCACTACCTAAAGTGATTGTTCCAGCA), beta actin (Mm00607939). Relative fold induction of a sample was calculated relative to mock treated sample using the ΔΔCt method.
Nandakumar R., Tschismarov R., Meissner F., Prabakaran T., Krissanaprasit A., Farahani E., Zhang B.C., Assil S., Martin A., Bertrams W., Holm C.K., Ablasser A., Klause T., Thomsen M.K., Schmeck B., Howard K.A., Henry T., Gothelf K.V., Decker T, & Paludan S.R. (2019). Intracellular bacteria engage a STING-TBK1-MVB12b pathway to enable paracrine cGAS-STING signaling. Nature microbiology, 4(4), 701-713.
+ Open protocol
+ Expand
2

Quantifying Interferon and Cytokine Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA was isolated using High Pure mRNA isolation kit (Roche) according to manufacturer’s instructions. qPCR was performed on extracted mRNA using Taqman primers Ifnb1 (Mm00439552), Ifna4 (Mm00833969), Tnfa (Mn00443258_m1), FlaA (FlaA Fwd GTTCAATCTTGCAACGTATGCGTC, FlaA Rev CCACTACCTAAAGTGATTGTTCCAGCA), beta actin (Mm00607939). Relative fold induction of a sample was calculated relative to mock treated sample using the ΔΔCt method.
Nandakumar R., Tschismarov R., Meissner F., Prabakaran T., Krissanaprasit A., Farahani E., Zhang B.C., Assil S., Martin A., Bertrams W., Holm C.K., Ablasser A., Klause T., Thomsen M.K., Schmeck B., Howard K.A., Henry T., Gothelf K.V., Decker T, & Paludan S.R. (2019). Intracellular bacteria engage a STING-TBK1-MVB12b pathway to enable paracrine cGAS-STING signaling. Nature microbiology, 4(4), 701-713.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!