Dna ligation kit ver 2

Cells were harvested and digested with 100 μg/ml Proteinase K in lysis buffer (10 μM Tris-HCl, 0.4 M NaCl, 2 μM EDTA and 1% SDS). Genomic DNA was extracted by phenol-chloroform and alcohol precipitation. The T7EN cleavage assay was performed as follows: briefly, targeted regions of PD1 were PCR-amplified from genomic DNA using rTaq (Takara, DR001BM) and the products were purified with a PCR cleanup kit (Axygen, APPCR-50). Purified PCR product was denatured and re-annealed in NEBuffer 2 (NEB) using a thermocycler (ABI, Veriti9902). Hybridized PCR products were digested with T7EN1 (NEB, M0302L) for 30 m and separated by 2% agarose gel. Primers for PCR are listed in Supplementary Table 3. The purified PCR products were ligated with pMD19T vector (Takara, 6013) using DNA ligation Kit Ver. 2.1 (Takara, 6022). Ligation products were used for transformation and about 20 ~ 30 colonies per kind are sequenced by using universal primer M13F.

The yiaD gene of AB5116 was amplified by PCR using PrimeSTAR Max DNA polymerase. The fragment was cloned into pAT03, an isopropyl β-D-1-thiogalactopyranoside (IPTG)-induced expression vector in A. baumannii (57 (link)), using DNA Ligation Kit Ver.2.1 (TaKaRa), and then further transformed into DH5α to obtain the plasmid pAT03-yiaD. The competent AB5116ΔyiaD::kan cells were transformed with the target plasmid, which was confirmed by sequencing, and subsequently grown on LB agar containing carbenicillin and IPTG. Complementation of yiaD was confirmed by PCR using the yiaDqPCR primer set.

The genomic DNA was extracted from each Tn mutant using the E.Z.N.A.^® Bacterial DNA kit (Omega, Norcross, GA, USA), and the Tn insertion site was determined by using a linker PCR. Briefly, 25 µg genomic DNA was digested with 3 units of AluI for 1 h at 37 °C and cleaned up with a MiniElute PCR Purification kit (Qiagen, Hilden, Germany). The linker primers 254/256 were annealed via incubation at 95 °C for 2 min and slowly cooled on bench, and then, they were ligated to the digested genomic DNA using a DNA Ligation Kit Ver.2.1 (Takara, Japan) at 16 °C for at least 2 h. The ligation product was cleaned up with QiaQuick PCR purification kit (Qiagen, Hilden, Germany). Eventually, linker PCR with another pair of primers Tn917-seq/258 was performed, and all products were subjected to DNA sequencing by Quintara Bio, Wuhan, China. The Tn insertion sites were determined by mapping the sequencing results of the PCR products to the genome sequence of S. suis SC19 (GenBank accession number NZ_CP020863).
CGView Server was used to visualize the distribution of the inserted genes involved in the mutant library on the S. suis SC19 genome [27 (link)]. For KEGG pathway enrichment, BlastKOALA tool was first used to assign the K number to each gene [28 (link)]. The K number was then used to map each gene to the corresponding KEGG pathway using the Reconstruct tool of the KEGG mapper [29 (link)].

The sequences of the 2000bp before the 5′-UTR of AC007271.3 were regarded as promoter region and obtained from Ensemble database (http://asia.ensembl.org/index.html). According to the sequences, we designed several primers with specific restriction enzyme protection sites of KpnI and Bgl II, respectively, for amplification the fragments (−1998/−2, −1508/−2, −1000/−2, −519/−2). Genomic DNA was used as a template to amplify by KOD-Plus-Neo (TOYOBO, Osaka, Japan) amplification enzyme. The reaction conditions were set following the instruction. 1% agarose gel electrophoresis was performed to select the bands in correct size and confirmed through sequencing (Sangon, Shanghai, China). The pGL3-Basic vector and correct fragments were digested with KpnI (TakaraBio, Dalian, China) and Bgl II (TakaraBio, Dalian, China) restriction enzymes. DNA ligation kit ver.2.1 (TakaraBio, Dalian, China) was used to connect the fragments and pGL3-Basic vector. DH5α competent cells were used for transformation. After the monoclonal colony sequence confirmation, the plasmids were extracted by using HiPure Plasmid EF Mini Kit (Magen, Guangzhou, China) for identification of core promoter of AC007271.3 by Dual-luciferase reporter assay.

For the analysis of minigene splicing products, PCR products were gel extracted with QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) and subcloned in pT7Blue T‐vector (Novagen, Madison, WI, USA) using DNA Ligation kit Ver. 2.1 (Takara Bio Inc.). The subcloned insert was sequenced by Applied Biosystems 3730xl DNA Analyzer at FASMAC Co. Ltd. (Atsugi) using two primers (YH307: 5′‐attactcgctcagaagctgtgttgc‐3′ and YH308: 5′‐aagtctctcacttagcaactggcag‐3′) for exons A and B.

TRIzol Universal Total RNA Extraction Reagent (cat. no. DP405; Tiangen, Beijing, China) was used to extract RNA from samples. A PrimeScript 1st Strand cDNA Synthesis Kit, 3′-Full RACE Core Set with PrimeScriptRTase, and Smarter RACE 5′/3′ Kit were used to synthesize cDNA (TaKaRa, Dalian, China). TaKaRaTksGflex DNA Polymerase was used for PCR. A TakaRaMiniBEST Agarose Gel DNA Extraction Kit ver. 4.0 was used to recover and purify the PCR product bands. The purified products were treated with a DNA A-Tailing Kit. Ligase from TaKaRa DNA Ligation Kit ver. 2.1 was used for ligation with the T-Vector pMDTM20. The plasmid was heat transferred into Escherichia coli competent cells (JM109), and cells were cultured overnight at 37 °C. Positive single clones were selected and designated CTG0957-PCR-1 and CTG0957-PCR-2. The primers M13-47 and RV-M were used for sequencing.