Sirna target finder

Based on the LDH-A sequence, shRNA was designed using siRNA Target Finder (Ambion): The nucleotide sequence of the inserted ShLDH-A was 5′-ATCCAGTGGATATCTTGACCTACG TGGCT-3′. The cell line generated by infecting cells with scrambled plasmid was used as a control. 10 µg shRNA and 25 µl Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) were mixed together with 1350 µl RPMI-1640 medium (without FBS), and then the mixture was transfected into MGC-803 gastric cancer cells. The mixture was added into a 25-cm² culture flask that was previously plated with 1×10⁶ MGC-803 gastric cancer cells. The culture medium was replaced with complete RPMI-1640 medium 6 h following inoculation and at 28 h after transfection, stable cell clones were selected for 2 weeks with neomycin and analyzed by immunoblotting.

Each siRNA duplex was designed to target the coding sequence of human ST3Gal III, FUT III and VII mRNA, and plant chlorophyll a/b-binding protein mRNA was used as a negative control, and synthesized by Bioneer corp. (Daejeon, Korea). The target sequences of ST3Gal III, FUT III and VII siRNAs are 5′-CCUGCUGAAUUAGCCACCAdTdT-3′, 5′-CACACUCAGGUGACCUACAdTdT-3′ and 5′-CCCUGAACAAAUCUUGGGUdTdT-3′ respectively. HBx-transfected cells were co-transfected with ST3Gal III, FUT III, VII siRNAs and negative control siRNA respectively by using LipofectAMINE (Invitrogen) according to the manufacturer’s instructions. One day after transfection, the cells were used for experiments. In order to silence with β-1, 3 GalT 5 gene, three pairs of oligonucleotides were designed by the siRNA target finder (Ambion). Different regions of human β-1,3 GalT 5 gene were annealed and cloned in the pSilencer™ 3.1-H1 puro expression vector (Ambion, Austin, TX) digested with HindIII/BamHI double digested pMEHMpuro. Three target sequences were; (1) AAGGGAAAGCAGCTGAAGACA, (2) AAGTGGTTTGTCAGTAAATCT, (3) CTCGAAAGGCTGAACATCAGATTGG. After transfection with shRNA vectors using the Welfect method (Welgene, Daegu, Korea), cells were selected by puromycin (250 ng/mL) and used in the experiments.