RT-PCR and real-time PCR were performed using standard methods as described 59 , 64 , 73 . The first-strand cDNA was generated by reverse transcription with random primers using Transcriptor First Strand cDNA Synthesis Kit (Roche, #04896866001). Standard RT-PCR was performed using GoTaq DNA polymerase (Promega, #M3005). To quantify the mRNA levels using real-time PCR, aliquots of first-strand cDNA were amplified with gene-specific primers and universal SYBR Green PCR supermix (Bio-Rad, #172-5124) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 20-40 ng of cDNA (except the cDNA for the IP, for which 5% of the cDNA was used for each gene examined), and 300 nM of forward and reverse primers in a final reaction volume of 20 μl. The sequences of primers used for RT-PCR reactions are as the following:
Sybr green pcr supermix
Manufactured by Bio-Rad
Sourced in United States
SYBR Green PCR Supermix is a ready-to-use solution for real-time quantitative PCR (qPCR) amplification and detection. It contains SYBR Green I dye, a DNA-binding fluorescent dye, and all the necessary components for PCR amplification and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Iscript cdna synthesis kit, by Bio-Rad (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Step 1 real time pcr system, by Thermo Fisher Scientific (5 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (5 mentions)
Cfx96 real time system, by Bio-Rad (5 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (4 mentions)
Transscript one step gdna removal and cdna synthesis supermix kit, by Transgene (4 mentions)
Gotaq dna polymerase, by Promega (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Rnaeasy kit, by Qiagen (3 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Trizol reagent, by Merck Group (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time pcr system, by Bio-Rad (2 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
55 protocols using sybr green pcr supermix
1
Quantitative mRNA Expression Analysis
2
Polarized BMDM Transcription Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMDMs were plated in 12-well plates as described
previously. After polarization to M1 and M2, the MnPEGDB fabricated
with a 0.75 mM copper catalyst was used to form polyplexes with either
scrambled siRNA or IκBα siRNA. BMDMs were treated for
24 h before mRNA was isolated from the cultured cells using the RNeasy
Mini kit (Qiagen, Valencia, CA). Residual DNA was removed using the
RNase-Free DNase set (Qiagen). cDNA synthesis was performed using
SuperScript IV reverse transcriptase kit (Invitrogen). The RT-PCR
reaction was performed using an SYBR Green PCR super mix (Bio-Rad)
and CFX real-time PCR instrument and software (Bio-Rad). Normalized
levels of mRNA expression were calculated using the ΔΔCt
method with GAPDH as an internal control. Each mRNA was normalized
to an untreated control group of the corresponding polarization (M1
vs M2). All primer sequences used are summarized in Supporting InformationTable S1 .
previously. After polarization to M1 and M2, the MnPEGDB fabricated
with a 0.75 mM copper catalyst was used to form polyplexes with either
scrambled siRNA or IκBα siRNA. BMDMs were treated for
24 h before mRNA was isolated from the cultured cells using the RNeasy
Mini kit (Qiagen, Valencia, CA). Residual DNA was removed using the
RNase-Free DNase set (Qiagen). cDNA synthesis was performed using
SuperScript IV reverse transcriptase kit (Invitrogen). The RT-PCR
reaction was performed using an SYBR Green PCR super mix (Bio-Rad)
and CFX real-time PCR instrument and software (Bio-Rad). Normalized
levels of mRNA expression were calculated using the ΔΔCt
method with GAPDH as an internal control. Each mRNA was normalized
to an untreated control group of the corresponding polarization (M1
vs M2). All primer sequences used are summarized in Supporting Information
3
Quantifying mRNA Levels by Real-Time PCR
4
RNA Extraction and Real-Time qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNAs were extracted using Trizol reagent (Sigma) according to the instructions of the user manual. cDNAs were generated from 1μg RNA using the High Capacity cDNA Reverse Transcription Kit (Life Technologies). Real-time PCR analyses were conducted with SYBR Green PCR Supermix (Bio-Rad) using PCR primers on a CFX96 Real Time PCR system (Bio-Rad). β-actin primer sequences were as follows: 5' GTGACGTTGACATCCGTAAAG 3' (forward) and 5' GCCGGACTCATCGTACTCC 3' (reverse); Mouse CXCL10 primer sequences were as follows: 5' CTCGCAAGGACGGTCCGCTG 3' (forward) and 5' CGTGGCAATGATCTCAACACGTGG 3' (reverse). Human CXCL10 primer sequences were as follows: 5’ GCCTCTAGACTGAGAATTCTGATAAACCC 3’ and 5’ CACCAAATCAGCTGCTACTA 3’ (reverse). Relative mRNA expression was determined by the comparative Ct method using Bio-Rad software (Bio-Rad).
5
Quantitative RT-PCR Analysis of Litchi Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The first strand cDNA synthesis was generated using 2 μg total RNA isolated from litchi AZ tissues according to the manufacturer's instructions of TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (TransGen, Beijing). Hundred nanograms of synthesized cDNA was used as a template to perform quantitative RT-PCR analysis. PCR reactions were performed in the total volume of 20 μL, with 0.5 μL for each primer (10 mm, final concentration 100 nm) and 10 μL for SYBR Green PCR Supermix (Bio-Rad) on a ABI7500 Real-Time PCR System (Applied Biosystems). The PCR program included an initial denaturation step at 94°C for 3 min, followed by 40 cycles of 5 s at 94°C and 1 min at 60°C. Each sample was quantified at least triplicate and normalized using EF-1a as an internal control for litchi (Zhong et al., 2011 (link)). The gene-specific primer pairs for quantitative Real-Time PCR are listed in Table S1 . All PCR reactions were normalized using Ct value corresponding to the reference gene. The relative expression levels of the target gene were calculated with formula 2−ddCt (Livak and Schmittgen, 2001 (link)). Values represented the average of three biological replicates.
6
Assessing Pro-inflammatory Gene Expression in THP-1 Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We assessed the expression of pro-inflammatory genes (IL-6 and TNFα) expressed by THP-1 M0 macrophages in the presence or absence (control) of 7-epi-clusianone using rt-PCR. M1 macrophages were used as a positive control to assess M0 macrophage polarization. Total RNA was isolated using the Gene Jet RNA Purification kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The RNA was prepared as a template for complementary deoxyribonucleic acid (cDNA) synthesis using the iScript cDNA Synthesis kit (Bio-Rad, Hercules, California). Quantitative rt-PCR analysis was performed with the synthesized cDNA and SYBR Green PCR Supermix (Bio-Rad, Hercules, CA, USA). Gene expression was normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and the control group, non-treated THP-1 M0 macrophages (2−ΔΔC). Gene expression values were calculated by using the mean cycle threshold (CT) values of the samples. All primers (Table S3 ) were synthetized by Integrated DNA Technologies (Integrated DNA Technologies, Coralville, IA, USA).
7
Real-Time qPCR Quantification of mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR assays were performed using standard methods as previously described39 ,89 (link). The first-strand cDNA was generated by reverse transcription with both oligo dT primer and random primers using PrimeScriptTM RT Reagent Kit (Takara, #RR037A). To quantify the mRNA levels using real-time PCR, aliquots of first-strand cDNA were amplified with gene-specific primers and universal SYBR Green PCR supermix (Bio-Rad, #172-5124) using a Step-1 Real-Time PCR System (Applied Biosystems). The PCR reactions contained 20–40 ng of cDNA and 300 nM of forward and reverse primers in a final reaction volume of 20 μl. The primers used for PCR are listed in Supplementary Data 3 .
8
Validating RNA-Seq Accuracy via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The accuracy of RNA-Seq was validated by qRT-PCR by randomly selecting five DElncRNAs and seven DEmRNAs. cDNA for qRT-PCR was synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China), and qRT-PCR was performed using the SYBR® Green PCR Supermix (Bio-Rad, CA, United States). Specific primers for the lncRNAs and mRNAs were designed using Primer Premier 5.0 (shown in Table 1 ). Each 20-μL reaction mixture included 10 μL of SYBR® Green PCR Supermix, 1 μL of each primer, 1 μL of cDNA, and 7 μL of RNase-free H2O. The PCR reaction conditions were as follows: an initial single cycle at 95°C for 1 min, 34 cycles at three different settings (95°C for 30 s, 58°C for 30 s, and 72°C for 1 min), and a final step at 72°C for 1 min. The dissociation curve of amplified products was used to evaluate product specificity. Relative expression levels were normalized to GAPDH with the 2–ΔΔCt method.
9
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was performed using a CFX96 Connect apparatus (BioRad). The reactions were carried out in triplicates using the SYBR Green PCR super-mix (BioRad), following the manufacturer's instructions. Each reaction was performed on 5 ng of cDNA in a final volume of 10 μL, primers were used at a concentration of 300 nM. Thermocycler program consisted of an initial hot start cycle at 95°C for 3 min, followed by 40 cycles at 95°C for 10 sec and 60°C for 30 sec. To confirm product specificity, a melting curve analysis was performed after each amplification.
The initial panel of genes was analyzed with custom plates preloaded with primers of interest (BioRad). For subsequent experiments, the primer sequences, reported inTable 2 , were designed using the software Beacon Designer 7® (BioRad).
The initial panel of genes was analyzed with custom plates preloaded with primers of interest (BioRad). For subsequent experiments, the primer sequences, reported in
10
Quantifying Endothelial Marker Expression in HB Scaffolds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was used to determine the expression of endothelial markers in HB scaffolds containing SMC/EC/Fibrin. HB/EC/Fibrin constructs were used as controls, and served as the normalization standard for PCR data. Briefly, total cellular RNA was prepared using Trizol Reagent (Life Technologies, 15596026, CA, USA). Single-stranded cDNA was synthesized using the reverse transcription-PCR protocol of the First Strand cDNA Synthesis Kit from Invitrogen. Quantitative real-time PCR was performed using SYBR Green PCR Supermix (Bio-Rad, CA, USA). Concentrations of all primers were optimized before use. PCR conditions included an initial denaturation step of 4 min at 95°C, followed by 40 cycles of PCR consisting of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. Each sample was run in triplicate. The comparative Ct value method using GAPDH as a housekeeping gene for an internal standard was employed to determine relative levels of gene expression. Ct values from the triplicate PCR reactions for a gene of interest (GOI) were normalized against average GAPDH Ct values from the same cDNA sample. Fold change of GOI transcript levels between sample A and sample B = 2-ΔΔCt, where ΔCt = Ct(GOI) – Ct(GAPDH) and ΔΔCt = ΔCt(A) – ΔCt(B). Primers were used in this study are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!